Incidental Mutation 'R5162:Gcm2'
ID397070
Institutional Source Beutler Lab
Gene Symbol Gcm2
Ensembl Gene ENSMUSG00000021362
Gene Nameglial cells missing homolog 2
SynonymsGcm1-rs2
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41101427-41111035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41103655 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 206 (N206S)
Ref Sequence ENSEMBL: ENSMUSP00000021791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021791] [ENSMUST00000225271]
Predicted Effect probably benign
Transcript: ENSMUST00000021791
AA Change: N206S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: N206S

DomainStartEndE-ValueType
Pfam:GCM 35 172 4.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Gcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Gcm2 APN 13 41103131 missense probably damaging 1.00
IGL01476:Gcm2 APN 13 41105741 missense probably damaging 1.00
IGL02034:Gcm2 APN 13 41105793 missense probably damaging 1.00
IGL02186:Gcm2 APN 13 41104649 missense possibly damaging 0.93
IGL02456:Gcm2 APN 13 41103001 missense probably benign 0.01
IGL03142:Gcm2 APN 13 41103235 missense probably benign 0.01
IGL03184:Gcm2 APN 13 41105412 missense probably damaging 1.00
PIT4403001:Gcm2 UTSW 13 41102839 missense probably benign 0.01
R0227:Gcm2 UTSW 13 41105856 missense probably damaging 0.99
R1061:Gcm2 UTSW 13 41105871 missense probably damaging 1.00
R1813:Gcm2 UTSW 13 41105891 missense probably benign 0.19
R2057:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2058:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2059:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2351:Gcm2 UTSW 13 41103618 missense probably benign 0.02
R4653:Gcm2 UTSW 13 41102841 missense probably benign 0.21
R4782:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R4799:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R5135:Gcm2 UTSW 13 41102959 missense probably benign
R5665:Gcm2 UTSW 13 41109911 missense possibly damaging 0.73
R5756:Gcm2 UTSW 13 41109896 missense probably damaging 1.00
R5771:Gcm2 UTSW 13 41103515 missense probably benign 0.40
R5928:Gcm2 UTSW 13 41103398 missense probably benign 0.00
R5977:Gcm2 UTSW 13 41103127 missense probably damaging 0.99
R6394:Gcm2 UTSW 13 41109897 missense probably damaging 1.00
R6578:Gcm2 UTSW 13 41105678 missense probably damaging 1.00
R6798:Gcm2 UTSW 13 41105885 missense probably damaging 1.00
R7088:Gcm2 UTSW 13 41103364 missense probably damaging 0.98
R7413:Gcm2 UTSW 13 41105754 missense probably damaging 1.00
R7456:Gcm2 UTSW 13 41103275 missense probably benign 0.02
Z1088:Gcm2 UTSW 13 41102792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCATAGCCCCAAGGTGG -3'
(R):5'- TGTGAACTGTAACAGGGCATGG -3'

Sequencing Primer
(F):5'- CCCGGGGAAATAAATGCTTG -3'
(R):5'- GGTGAGGGTATTCATATCCTT -3'
Posted On2016-06-21