Incidental Mutation 'R5162:Vmn2r89'
ID 397073
Institutional Source Beutler Lab
Gene Symbol Vmn2r89
Ensembl Gene ENSMUSG00000070448
Gene Name vomeronasal 2, receptor 89
Synonyms V2r10, V2r11
MMRRC Submission 042744-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R5162 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 51689419-51698750 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 51693620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 323 (H323Q)
Ref Sequence ENSEMBL: ENSMUSP00000124256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159611] [ENSMUST00000159734] [ENSMUST00000161670] [ENSMUST00000162998]
AlphaFold O35199
Predicted Effect possibly damaging
Transcript: ENSMUST00000159611
AA Change: H323Q

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124065
Gene: ENSMUSG00000070448
AA Change: H323Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 449 4.8e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159734
AA Change: H323Q

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124256
Gene: ENSMUSG00000070448
AA Change: H323Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 420 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161670
SMART Domains Protein: ENSMUSP00000124261
Gene: ENSMUSG00000070448

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,301 (GRCm39) T229S probably benign Het
Adrb3 T C 8: 27,717,348 (GRCm39) E367G probably benign Het
Ak9 T A 10: 41,233,653 (GRCm39) N630K probably damaging Het
Atp8b1 T C 18: 64,694,733 (GRCm39) I516M possibly damaging Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Cry1 T A 10: 84,969,150 (GRCm39) H558L probably benign Het
Cstdc3 A T 16: 36,132,918 (GRCm39) H65L probably damaging Het
Cyp3a57 T A 5: 145,305,893 (GRCm39) W126R probably damaging Het
Dhx36 A T 3: 62,401,201 (GRCm39) V355E probably damaging Het
Dpp6 A G 5: 27,604,013 (GRCm39) probably benign Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Enpp2 T C 15: 54,710,692 (GRCm39) D694G probably benign Het
Esrp2 T C 8: 106,859,930 (GRCm39) E336G probably damaging Het
Faah A T 4: 115,857,938 (GRCm39) probably benign Het
Fat1 G A 8: 45,478,846 (GRCm39) G2608R probably benign Het
Fbxo8 A T 8: 57,022,354 (GRCm39) Y122F probably damaging Het
Fgd5 A G 6: 92,051,215 (GRCm39) D1497G probably damaging Het
Fn3krp T C 11: 121,320,410 (GRCm39) F252L probably damaging Het
Fnip2 T C 3: 79,389,084 (GRCm39) Y549C probably damaging Het
Gcm2 T C 13: 41,257,131 (GRCm39) N206S probably benign Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
H2-T10 T A 17: 36,429,843 (GRCm39) probably null Het
Henmt1 T C 3: 108,847,366 (GRCm39) probably null Het
Man1b1 T A 2: 25,233,365 (GRCm39) L246Q probably damaging Het
Mdh2 T C 5: 135,812,329 (GRCm39) probably null Het
Mocos T C 18: 24,787,109 (GRCm39) F43L probably damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Naip5 T A 13: 100,359,914 (GRCm39) I441F possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,709,027 (GRCm39) probably benign Het
Ncoa2 A T 1: 13,245,396 (GRCm39) M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 (GRCm38) noncoding transcript Het
Or14j8 T A 17: 38,263,255 (GRCm39) Q220L probably benign Het
Or9a2 G T 6: 41,748,706 (GRCm39) H176N possibly damaging Het
Pals2 T A 6: 50,155,495 (GRCm39) W259R probably damaging Het
Pars2 A G 4: 106,511,735 (GRCm39) T506A probably benign Het
Pkp2 T C 16: 16,078,200 (GRCm39) S481P probably damaging Het
Plod3 T C 5: 137,020,161 (GRCm39) W459R probably damaging Het
Pramel13 A T 4: 144,121,482 (GRCm39) L181M probably damaging Het
Prdm10 A T 9: 31,251,714 (GRCm39) I361F possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Raver2 T C 4: 100,959,921 (GRCm39) C134R probably damaging Het
Rnf130 G C 11: 49,943,722 (GRCm39) A123P probably damaging Het
Slc29a4 G A 5: 142,707,207 (GRCm39) A517T possibly damaging Het
Slc38a6 T A 12: 73,376,759 (GRCm39) S138T possibly damaging Het
Spred1 T C 2: 117,008,102 (GRCm39) V336A possibly damaging Het
Sptlc3 T A 2: 139,473,263 (GRCm39) M504K probably benign Het
Syt11 T C 3: 88,655,149 (GRCm39) D78G probably damaging Het
Trim23 C T 13: 104,317,682 (GRCm39) T61I probably damaging Het
Tsg101 T C 7: 46,542,174 (GRCm39) T260A probably damaging Het
Tyw5 T C 1: 57,440,618 (GRCm39) Y48C probably damaging Het
Utp25 G T 1: 192,796,089 (GRCm39) T192K probably damaging Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Vps18 A G 2: 119,123,423 (GRCm39) S117G probably benign Het
Zfp93 C G 7: 23,975,757 (GRCm39) Q581E probably damaging Het
Other mutations in Vmn2r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Vmn2r89 APN 14 51,692,422 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r89 APN 14 51,694,950 (GRCm39) missense probably benign
IGL00990:Vmn2r89 APN 14 51,693,428 (GRCm39) missense probably benign 0.14
IGL01991:Vmn2r89 APN 14 51,689,676 (GRCm39) missense probably benign 0.00
IGL03073:Vmn2r89 APN 14 51,693,528 (GRCm39) missense possibly damaging 0.95
IGL03085:Vmn2r89 APN 14 51,689,615 (GRCm39) missense probably damaging 0.99
IGL03278:Vmn2r89 APN 14 51,692,557 (GRCm39) missense probably damaging 0.99
R0115:Vmn2r89 UTSW 14 51,693,577 (GRCm39) missense probably damaging 1.00
R0127:Vmn2r89 UTSW 14 51,693,160 (GRCm39) missense probably damaging 0.98
R0391:Vmn2r89 UTSW 14 51,693,435 (GRCm39) missense probably damaging 0.99
R0481:Vmn2r89 UTSW 14 51,693,577 (GRCm39) missense probably damaging 1.00
R0538:Vmn2r89 UTSW 14 51,695,048 (GRCm39) splice site probably null
R1210:Vmn2r89 UTSW 14 51,692,427 (GRCm39) missense probably benign 0.01
R1332:Vmn2r89 UTSW 14 51,692,559 (GRCm39) missense probably benign 0.00
R1660:Vmn2r89 UTSW 14 51,693,693 (GRCm39) missense possibly damaging 0.48
R1959:Vmn2r89 UTSW 14 51,694,897 (GRCm39) missense probably benign 0.22
R2876:Vmn2r89 UTSW 14 51,692,541 (GRCm39) missense possibly damaging 0.47
R3410:Vmn2r89 UTSW 14 51,693,628 (GRCm39) missense probably damaging 0.98
R4026:Vmn2r89 UTSW 14 51,689,500 (GRCm39) start codon destroyed probably null 1.00
R4398:Vmn2r89 UTSW 14 51,689,551 (GRCm39) missense probably damaging 1.00
R4700:Vmn2r89 UTSW 14 51,694,942 (GRCm39) missense probably damaging 1.00
R4714:Vmn2r89 UTSW 14 51,689,688 (GRCm39) missense probably damaging 0.97
R5294:Vmn2r89 UTSW 14 51,692,570 (GRCm39) missense probably benign 0.00
R5811:Vmn2r89 UTSW 14 51,693,565 (GRCm39) missense probably benign 0.12
R6087:Vmn2r89 UTSW 14 51,695,033 (GRCm39) splice site probably null
R6229:Vmn2r89 UTSW 14 51,693,178 (GRCm39) missense probably benign 0.05
R6246:Vmn2r89 UTSW 14 51,693,503 (GRCm39) missense probably damaging 1.00
R6572:Vmn2r89 UTSW 14 51,693,450 (GRCm39) missense probably damaging 1.00
R7351:Vmn2r89 UTSW 14 51,693,739 (GRCm39) missense probably benign 0.30
R7683:Vmn2r89 UTSW 14 51,692,651 (GRCm39) missense probably benign
R7974:Vmn2r89 UTSW 14 51,693,459 (GRCm39) missense probably damaging 1.00
R8047:Vmn2r89 UTSW 14 51,692,549 (GRCm39) missense probably benign 0.05
R8093:Vmn2r89 UTSW 14 51,693,699 (GRCm39) missense probably benign 0.00
R8348:Vmn2r89 UTSW 14 51,692,548 (GRCm39) missense possibly damaging 0.90
R8723:Vmn2r89 UTSW 14 51,693,910 (GRCm39) missense probably benign
R8737:Vmn2r89 UTSW 14 51,693,722 (GRCm39) missense probably damaging 1.00
R8859:Vmn2r89 UTSW 14 51,693,170 (GRCm39) missense probably benign
R9183:Vmn2r89 UTSW 14 51,692,501 (GRCm39) missense probably benign 0.01
R9197:Vmn2r89 UTSW 14 51,693,596 (GRCm39) missense possibly damaging 0.70
R9377:Vmn2r89 UTSW 14 51,692,601 (GRCm39) missense probably benign 0.02
R9395:Vmn2r89 UTSW 14 51,693,783 (GRCm39) missense probably damaging 1.00
R9452:Vmn2r89 UTSW 14 51,693,288 (GRCm39) missense probably damaging 0.99
R9457:Vmn2r89 UTSW 14 51,693,469 (GRCm39) missense probably damaging 0.99
R9678:Vmn2r89 UTSW 14 51,693,511 (GRCm39) missense probably benign 0.09
X0019:Vmn2r89 UTSW 14 51,693,872 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAGATATACATGACAAGGGC -3'
(R):5'- GCTGTCCATTCCAATGTGTTG -3'

Sequencing Primer
(F):5'- ATGACATCTTCAGCAAAGGTTG -3'
(R):5'- TGTGTTGTTGGATGTAAAAAGATCC -3'
Posted On 2016-06-21