Mutagenetix > Incidental Mutations

Incidental Mutation 'R5162:Enpp2'

397074

Institutional Source

Beutler Lab

Gene Symbol

Enpp2

Ensembl Gene

ENSMUSG00000022425

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 2

Synonyms

Pdnp2, Npps2, PD-Ialpha, ATX, Autotaxin

MMRRC Submission

042744-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54838901-54952892 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54847296 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 694 (D694G)

Ref Sequence

ENSEMBL: ENSMUSP00000036180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516]

Predicted Effect

probably benign
Transcript: ENSMUST00000041591
AA Change: D694G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425
AA Change: D694G

Domain	Start	End	E-Value	Type
SO	54	97	4.79e-16	SMART
SO	98	141	2.95e-16	SMART
Pfam:Phosphodiest	165	285	4.7e-41	PFAM
Pfam:Phosphodiest	278	477	3.3e-40	PFAM
Endonuclease_NS	613	844	3.93e-36	SMART
NUC	614	844	1.32e-109	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167541
AA Change: D719G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425
AA Change: D719G

Domain	Start	End	E-Value	Type
SO	54	97	4.79e-16	SMART
SO	98	141	2.95e-16	SMART
Pfam:Phosphodiest	165	284	5.4e-41	PFAM
Pfam:Phosphodiest	278	477	3.4e-40	PFAM
Endonuclease_NS	638	869	3.93e-36	SMART
NUC	639	869	1.32e-109	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171545
AA Change: D746G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425
AA Change: D746G

Domain	Start	End	E-Value	Type
SO	54	97	4.79e-16	SMART
SO	98	141	2.95e-16	SMART
Pfam:Phosphodiest	165	283	2.8e-43	PFAM
Pfam:Phosphodiest	275	529	2.8e-36	PFAM
Endonuclease_NS	665	896	3.93e-36	SMART
NUC	666	896	1.32e-109	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173516
AA Change: D742G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425
AA Change: D742G

Domain	Start	End	E-Value	Type
SO	54	97	4.79e-16	SMART
SO	98	141	2.95e-16	SMART
Pfam:Phosphodiest	165	285	2.8e-41	PFAM
Pfam:Phosphodiest	276	529	7.8e-36	PFAM
Endonuclease_NS	661	892	3.93e-36	SMART
NUC	662	892	1.32e-109	SMART

Meta Mutation Damage Score

0.7786

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,293,671	T229S	probably benign	Het
Adrb3	T	C	8: 27,227,320	E367G	probably benign	Het
Ak9	T	A	10: 41,357,657	N630K	probably damaging	Het
Atp8b1	T	C	18: 64,561,662	I516M	possibly damaging	Het
Bcor	C	T	X: 12,040,486	R1551Q	probably damaging	Het
Cry1	T	A	10: 85,133,286	H558L	probably benign	Het
Cyp3a57	T	A	5: 145,369,083	W126R	probably damaging	Het
Dhx36	A	T	3: 62,493,780	V355E	probably damaging	Het
Diexf	G	T	1: 193,113,781	T192K	probably damaging	Het
Dpp6	A	G	5: 27,399,015		probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Esrp2	T	C	8: 106,133,298	E336G	probably damaging	Het
Faah	A	T	4: 116,000,741		probably benign	Het
Fat1	G	A	8: 45,025,809	G2608R	probably benign	Het
Fbxo8	A	T	8: 56,569,319	Y122F	probably damaging	Het
Fgd5	A	G	6: 92,074,234	D1497G	probably damaging	Het
Fn3krp	T	C	11: 121,429,584	F252L	probably damaging	Het
Fnip2	T	C	3: 79,481,777	Y549C	probably damaging	Het
Gcm2	T	C	13: 41,103,655	N206S	probably benign	Het
Gm4758	A	T	16: 36,312,556	H65L	probably damaging	Het
Grn	C	A	11: 102,430,554		probably benign	Het
H2-T10	T	A	17: 36,118,951		probably null	Het
Henmt1	T	C	3: 108,940,050		probably null	Het
Man1b1	T	A	2: 25,343,353	L246Q	probably damaging	Het
Mdh2	T	C	5: 135,783,475		probably null	Het
Mocos	T	C	18: 24,654,052	F43L	probably damaging	Het
Mpp6	T	A	6: 50,178,515	W259R	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Naip5	T	A	13: 100,223,406	I441F	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nars2	T	C	7: 97,059,820		probably benign	Het
Ncoa2	A	T	1: 13,175,172	M434K	possibly damaging	Het
Nlrp4g	T	A	9: 124,350,394		noncoding transcript	Het
Olfr459	G	T	6: 41,771,772	H176N	possibly damaging	Het
Olfr761	T	A	17: 37,952,364	Q220L	probably benign	Het
Pars2	A	G	4: 106,654,538	T506A	probably benign	Het
Pkp2	T	C	16: 16,260,336	S481P	probably damaging	Het
Plod3	T	C	5: 136,991,307	W459R	probably damaging	Het
Pramef12	A	T	4: 144,394,912	L181M	probably damaging	Het
Prdm10	A	T	9: 31,340,418	I361F	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Raver2	T	C	4: 101,102,724	C134R	probably damaging	Het
Rnf130	G	C	11: 50,052,895	A123P	probably damaging	Het
Slc29a4	G	A	5: 142,721,452	A517T	possibly damaging	Het
Slc38a6	T	A	12: 73,329,985	S138T	possibly damaging	Het
Spred1	T	C	2: 117,177,621	V336A	possibly damaging	Het
Sptlc3	T	A	2: 139,631,343	M504K	probably benign	Het
Syt11	T	C	3: 88,747,842	D78G	probably damaging	Het
Trim23	C	T	13: 104,181,174	T61I	probably damaging	Het
Tsg101	T	C	7: 46,892,426	T260A	probably damaging	Het
Tyw5	T	C	1: 57,401,459	Y48C	probably damaging	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Vmn2r89	C	A	14: 51,456,163	H323Q	possibly damaging	Het
Vps18	A	G	2: 119,292,942	S117G	probably benign	Het
Zfp93	C	G	7: 24,276,332	Q581E	probably damaging	Het

Other mutations in Enpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00857:Enpp2	APN	15	54875650	critical splice donor site	probably null
IGL01290:Enpp2	APN	15	54919602	missense	possibly damaging	0.79
IGL01296:Enpp2	APN	15	54875669	missense	probably damaging	1.00
IGL01650:Enpp2	APN	15	54919933	missense	probably benign
IGL02470:Enpp2	APN	15	54839460	missense	probably damaging	1.00
IGL02522:Enpp2	APN	15	54898940	missense	probably damaging	0.99
IGL02727:Enpp2	APN	15	54910181	missense	probably damaging	1.00
IGL03178:Enpp2	APN	15	54866006	missense	probably benign
IGL03055:Enpp2	UTSW	15	54866085	intron	probably null
PIT4260001:Enpp2	UTSW	15	54844378	critical splice donor site	probably null
R0302:Enpp2	UTSW	15	54860061	missense	probably benign	0.15
R0304:Enpp2	UTSW	15	54877806	missense	probably benign	0.07
R0385:Enpp2	UTSW	15	54882159	missense	probably damaging	1.00
R0440:Enpp2	UTSW	15	54847237	splice site	probably benign
R0696:Enpp2	UTSW	15	54897696	nonsense	probably null
R0879:Enpp2	UTSW	15	54877930	missense	probably damaging	0.98
R0924:Enpp2	UTSW	15	54906959	splice site	probably benign
R0989:Enpp2	UTSW	15	54875759	missense	possibly damaging	0.88
R1126:Enpp2	UTSW	15	54906826	critical splice donor site	probably null
R1434:Enpp2	UTSW	15	54862681	missense	probably damaging	1.00
R1447:Enpp2	UTSW	15	54919598	critical splice donor site	probably null
R1464:Enpp2	UTSW	15	54863812	missense	probably damaging	1.00
R1464:Enpp2	UTSW	15	54863812	missense	probably damaging	1.00
R1501:Enpp2	UTSW	15	54839514	missense	probably damaging	1.00
R1546:Enpp2	UTSW	15	54845829	missense	probably benign	0.01
R1673:Enpp2	UTSW	15	54910196	splice site	probably null
R1853:Enpp2	UTSW	15	54845823	missense	probably damaging	1.00
R1854:Enpp2	UTSW	15	54845823	missense	probably damaging	1.00
R1855:Enpp2	UTSW	15	54845823	missense	probably damaging	1.00
R1969:Enpp2	UTSW	15	54882982	missense	probably damaging	1.00
R1970:Enpp2	UTSW	15	54882982	missense	probably damaging	1.00
R2060:Enpp2	UTSW	15	54875714	missense	probably damaging	1.00
R2122:Enpp2	UTSW	15	54897792	nonsense	probably null
R2275:Enpp2	UTSW	15	54897794	missense	probably damaging	1.00
R2517:Enpp2	UTSW	15	54919694	missense	probably damaging	0.99
R3881:Enpp2	UTSW	15	54919692	missense	probably damaging	1.00
R3934:Enpp2	UTSW	15	54845921	missense	probably benign	0.03
R4722:Enpp2	UTSW	15	54887589	missense	probably damaging	0.99
R4765:Enpp2	UTSW	15	54875672	missense	possibly damaging	0.91
R4799:Enpp2	UTSW	15	54910094	missense	probably damaging	1.00
R4934:Enpp2	UTSW	15	54882147	missense	probably damaging	1.00
R4976:Enpp2	UTSW	15	54870305	nonsense	probably null
R5068:Enpp2	UTSW	15	54864054	missense	probably damaging	1.00
R5069:Enpp2	UTSW	15	54864054	missense	probably damaging	1.00
R5070:Enpp2	UTSW	15	54864054	missense	probably damaging	1.00
R5119:Enpp2	UTSW	15	54870305	nonsense	probably null
R5134:Enpp2	UTSW	15	54899330	missense	probably damaging	1.00
R5218:Enpp2	UTSW	15	54887586	missense	possibly damaging	0.86
R5415:Enpp2	UTSW	15	54882156	missense	probably damaging	1.00
R5965:Enpp2	UTSW	15	54882971	critical splice donor site	probably null
R6086:Enpp2	UTSW	15	54845834	missense	probably damaging	1.00
R6229:Enpp2	UTSW	15	54877832	missense	probably damaging	1.00
R6306:Enpp2	UTSW	15	54899346	missense	probably damaging	1.00
R6314:Enpp2	UTSW	15	54865970	missense	probably damaging	0.99
R6403:Enpp2	UTSW	15	54863764	missense	probably damaging	1.00
R6515:Enpp2	UTSW	15	54860093	missense	possibly damaging	0.75
R6525:Enpp2	UTSW	15	54870211	missense	probably benign	0.01
R6536:Enpp2	UTSW	15	54862631	missense	probably damaging	1.00
R7070:Enpp2	UTSW	15	54899289	missense	probably damaging	1.00
R7077:Enpp2	UTSW	15	54901391	missense	probably benign	0.36
R7265:Enpp2	UTSW	15	54910033	critical splice donor site	probably null
R7324:Enpp2	UTSW	15	54877774	critical splice donor site	probably null
R7331:Enpp2	UTSW	15	54875670	missense	probably damaging	1.00
R7452:Enpp2	UTSW	15	54866736	missense	probably damaging	0.99
R7494:Enpp2	UTSW	15	54910158	missense	probably damaging	1.00
R7557:Enpp2	UTSW	15	54910140	missense	probably damaging	1.00
R7574:Enpp2	UTSW	15	54851417	missense	probably benign
R7665:Enpp2	UTSW	15	54839394	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TAGATGACTCACTGGCTTCCC -3'
(R):5'- TGGGACTGTTTAAAGAAGCTGATAG -3'

Sequencing Primer
(F):5'- CGCCCAGGTAGGTCATCTAC -3'
(R):5'- GGGGGAAATAAAAGAATAGATCTGCC -3'

Posted On

2016-06-21