Incidental Mutation 'R5162:Pkp2'
ID397075
Institutional Source Beutler Lab
Gene Symbol Pkp2
Ensembl Gene ENSMUSG00000041957
Gene Nameplakophilin 2
Synonyms1200008D14Rik, Pkp2l, 1200012P04Rik
MMRRC Submission 042744-MU
Accession Numbers

NCBI RefSeq: NM_026163.2; MGI: 1914701

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5162 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16213318-16272712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16260336 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 481 (S481P)
Ref Sequence ENSEMBL: ENSMUSP00000036890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039408]
Predicted Effect probably damaging
Transcript: ENSMUST00000039408
AA Change: S481P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036890
Gene: ENSMUSG00000041957
AA Change: S481P

DomainStartEndE-ValueType
low complexity region 258 271 N/A INTRINSIC
ARM 342 382 7.5e-9 SMART
ARM 384 425 5.14e-7 SMART
Blast:ARM 426 481 2e-29 BLAST
ARM 484 530 8.76e-1 SMART
ARM 631 672 2.98e-3 SMART
Blast:ARM 677 718 2e-11 BLAST
Blast:ARM 720 763 5e-17 BLAST
Meta Mutation Damage Score 0.6235 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype Strain: 3487374
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with impaired heart formation, hemopericardium, and hemoperitoneum. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Pkp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0014:Pkp2 UTSW 16 16240522 missense probably benign 0.08
R0131:Pkp2 UTSW 16 16240713 splice site probably benign
R0581:Pkp2 UTSW 16 16269783 splice site probably benign
R0722:Pkp2 UTSW 16 16247028 missense probably benign
R0882:Pkp2 UTSW 16 16269711 missense probably damaging 1.00
R0942:Pkp2 UTSW 16 16226030 missense probably benign
R1236:Pkp2 UTSW 16 16225902 missense probably benign
R1265:Pkp2 UTSW 16 16225304 missense probably benign 0.00
R1674:Pkp2 UTSW 16 16240558 missense possibly damaging 0.50
R1687:Pkp2 UTSW 16 16268709 critical splice donor site probably null
R1769:Pkp2 UTSW 16 16262697 missense probably damaging 1.00
R2094:Pkp2 UTSW 16 16246967 missense probably damaging 1.00
R4360:Pkp2 UTSW 16 16268682 missense probably benign 0.03
R4739:Pkp2 UTSW 16 16230724 missense probably damaging 0.99
R5607:Pkp2 UTSW 16 16260375 missense probably damaging 0.98
R6334:Pkp2 UTSW 16 16226069 missense probably damaging 0.99
R6918:Pkp2 UTSW 16 16272218 missense probably damaging 1.00
R7274:Pkp2 UTSW 16 16246929 missense possibly damaging 0.92
R7408:Pkp2 UTSW 16 16261673 missense possibly damaging 0.50
R7698:Pkp2 UTSW 16 16240659 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGATGTCTCCCTGGACTGATG -3'
(R):5'- TGGCTTTAGCAAGTAAGTCAAGG -3'

Sequencing Primer
(F):5'- CCTGGACTGATGATAAGCTCTGAC -3'
(R):5'- GCAAGTAAGTCAAGGAACAAAACTAC -3'
Posted On2016-06-21