Incidental Mutation 'R5162:Mocos'
ID 397080
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Name molybdenum cofactor sulfurase
Synonyms 1110018O12Rik
MMRRC Submission 042744-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.203) question?
Stock # R5162 (G1)
Quality Score 87
Status Validated
Chromosome 18
Chromosomal Location 24786748-24834632 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24787109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 43 (F43L)
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
AlphaFold Q14CH1
Predicted Effect probably damaging
Transcript: ENSMUST00000068006
AA Change: F43L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616
AA Change: F43L

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Meta Mutation Damage Score 0.6021 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,301 (GRCm39) T229S probably benign Het
Adrb3 T C 8: 27,717,348 (GRCm39) E367G probably benign Het
Ak9 T A 10: 41,233,653 (GRCm39) N630K probably damaging Het
Atp8b1 T C 18: 64,694,733 (GRCm39) I516M possibly damaging Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Cry1 T A 10: 84,969,150 (GRCm39) H558L probably benign Het
Cstdc3 A T 16: 36,132,918 (GRCm39) H65L probably damaging Het
Cyp3a57 T A 5: 145,305,893 (GRCm39) W126R probably damaging Het
Dhx36 A T 3: 62,401,201 (GRCm39) V355E probably damaging Het
Dpp6 A G 5: 27,604,013 (GRCm39) probably benign Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Enpp2 T C 15: 54,710,692 (GRCm39) D694G probably benign Het
Esrp2 T C 8: 106,859,930 (GRCm39) E336G probably damaging Het
Faah A T 4: 115,857,938 (GRCm39) probably benign Het
Fat1 G A 8: 45,478,846 (GRCm39) G2608R probably benign Het
Fbxo8 A T 8: 57,022,354 (GRCm39) Y122F probably damaging Het
Fgd5 A G 6: 92,051,215 (GRCm39) D1497G probably damaging Het
Fn3krp T C 11: 121,320,410 (GRCm39) F252L probably damaging Het
Fnip2 T C 3: 79,389,084 (GRCm39) Y549C probably damaging Het
Gcm2 T C 13: 41,257,131 (GRCm39) N206S probably benign Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
H2-T10 T A 17: 36,429,843 (GRCm39) probably null Het
Henmt1 T C 3: 108,847,366 (GRCm39) probably null Het
Man1b1 T A 2: 25,233,365 (GRCm39) L246Q probably damaging Het
Mdh2 T C 5: 135,812,329 (GRCm39) probably null Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Naip5 T A 13: 100,359,914 (GRCm39) I441F possibly damaging Het
Naip6 C T 13: 100,437,108 (GRCm39) A472T probably benign Het
Nars2 T C 7: 96,709,027 (GRCm39) probably benign Het
Ncoa2 A T 1: 13,245,396 (GRCm39) M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 (GRCm38) noncoding transcript Het
Or14j8 T A 17: 38,263,255 (GRCm39) Q220L probably benign Het
Or9a2 G T 6: 41,748,706 (GRCm39) H176N possibly damaging Het
Pals2 T A 6: 50,155,495 (GRCm39) W259R probably damaging Het
Pars2 A G 4: 106,511,735 (GRCm39) T506A probably benign Het
Pkp2 T C 16: 16,078,200 (GRCm39) S481P probably damaging Het
Plod3 T C 5: 137,020,161 (GRCm39) W459R probably damaging Het
Pramel13 A T 4: 144,121,482 (GRCm39) L181M probably damaging Het
Prdm10 A T 9: 31,251,714 (GRCm39) I361F possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Raver2 T C 4: 100,959,921 (GRCm39) C134R probably damaging Het
Rnf130 G C 11: 49,943,722 (GRCm39) A123P probably damaging Het
Slc29a4 G A 5: 142,707,207 (GRCm39) A517T possibly damaging Het
Slc38a6 T A 12: 73,376,759 (GRCm39) S138T possibly damaging Het
Spred1 T C 2: 117,008,102 (GRCm39) V336A possibly damaging Het
Sptlc3 T A 2: 139,473,263 (GRCm39) M504K probably benign Het
Syt11 T C 3: 88,655,149 (GRCm39) D78G probably damaging Het
Trim23 C T 13: 104,317,682 (GRCm39) T61I probably damaging Het
Tsg101 T C 7: 46,542,174 (GRCm39) T260A probably damaging Het
Tyw5 T C 1: 57,440,618 (GRCm39) Y48C probably damaging Het
Utp25 G T 1: 192,796,089 (GRCm39) T192K probably damaging Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Vmn2r89 C A 14: 51,693,620 (GRCm39) H323Q possibly damaging Het
Vps18 A G 2: 119,123,423 (GRCm39) S117G probably benign Het
Zfp93 C G 7: 23,975,757 (GRCm39) Q581E probably damaging Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24,793,101 (GRCm39) missense possibly damaging 0.88
IGL01859:Mocos APN 18 24,799,717 (GRCm39) splice site probably benign
IGL01884:Mocos APN 18 24,816,273 (GRCm39) missense probably damaging 1.00
IGL02174:Mocos APN 18 24,828,953 (GRCm39) missense probably benign 0.00
IGL02966:Mocos APN 18 24,809,668 (GRCm39) missense probably damaging 1.00
IGL02976:Mocos APN 18 24,799,626 (GRCm39) missense possibly damaging 0.92
buteo UTSW 18 24,799,467 (GRCm39) missense probably damaging 0.98
swainson UTSW 18 24,812,447 (GRCm39) missense probably damaging 1.00
P0008:Mocos UTSW 18 24,812,663 (GRCm39) missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24,819,759 (GRCm39) missense probably damaging 1.00
R0131:Mocos UTSW 18 24,812,819 (GRCm39) missense probably benign 0.01
R0131:Mocos UTSW 18 24,812,819 (GRCm39) missense probably benign 0.01
R0132:Mocos UTSW 18 24,812,819 (GRCm39) missense probably benign 0.01
R0265:Mocos UTSW 18 24,799,333 (GRCm39) missense probably benign 0.01
R0737:Mocos UTSW 18 24,822,044 (GRCm39) missense probably damaging 0.98
R1231:Mocos UTSW 18 24,812,758 (GRCm39) missense probably benign 0.01
R1351:Mocos UTSW 18 24,793,107 (GRCm39) missense probably damaging 1.00
R1699:Mocos UTSW 18 24,816,273 (GRCm39) missense probably damaging 1.00
R1853:Mocos UTSW 18 24,829,026 (GRCm39) missense probably damaging 1.00
R2190:Mocos UTSW 18 24,797,114 (GRCm39) missense probably benign 0.01
R2350:Mocos UTSW 18 24,799,713 (GRCm39) splice site probably benign
R2680:Mocos UTSW 18 24,809,686 (GRCm39) missense probably damaging 1.00
R3840:Mocos UTSW 18 24,809,681 (GRCm39) missense probably damaging 1.00
R3841:Mocos UTSW 18 24,809,681 (GRCm39) missense probably damaging 1.00
R3847:Mocos UTSW 18 24,809,719 (GRCm39) missense probably damaging 0.99
R4059:Mocos UTSW 18 24,812,447 (GRCm39) missense probably damaging 1.00
R4158:Mocos UTSW 18 24,807,303 (GRCm39) missense probably damaging 0.99
R4205:Mocos UTSW 18 24,799,248 (GRCm39) missense possibly damaging 0.88
R4514:Mocos UTSW 18 24,816,269 (GRCm39) missense probably damaging 0.99
R4589:Mocos UTSW 18 24,787,095 (GRCm39) missense probably damaging 0.99
R4667:Mocos UTSW 18 24,799,491 (GRCm39) missense probably benign 0.11
R4668:Mocos UTSW 18 24,799,491 (GRCm39) missense probably benign 0.11
R5187:Mocos UTSW 18 24,825,611 (GRCm39) missense probably damaging 0.97
R5533:Mocos UTSW 18 24,807,357 (GRCm39) missense probably damaging 1.00
R5629:Mocos UTSW 18 24,797,142 (GRCm39) critical splice donor site probably null
R5661:Mocos UTSW 18 24,799,052 (GRCm39) splice site probably null
R5952:Mocos UTSW 18 24,834,444 (GRCm39) missense possibly damaging 0.91
R5987:Mocos UTSW 18 24,819,750 (GRCm39) missense probably damaging 1.00
R6173:Mocos UTSW 18 24,809,639 (GRCm39) missense probably benign 0.03
R6209:Mocos UTSW 18 24,799,672 (GRCm39) missense probably benign 0.41
R6376:Mocos UTSW 18 24,834,542 (GRCm39) missense possibly damaging 0.50
R6416:Mocos UTSW 18 24,834,513 (GRCm39) missense probably damaging 0.99
R6452:Mocos UTSW 18 24,828,998 (GRCm39) missense probably benign 0.02
R6520:Mocos UTSW 18 24,799,447 (GRCm39) missense probably benign 0.01
R6631:Mocos UTSW 18 24,832,988 (GRCm39) missense probably benign 0.03
R6669:Mocos UTSW 18 24,799,467 (GRCm39) missense probably damaging 0.98
R7114:Mocos UTSW 18 24,799,572 (GRCm39) missense probably damaging 1.00
R7366:Mocos UTSW 18 24,809,673 (GRCm39) missense probably damaging 1.00
R7690:Mocos UTSW 18 24,797,082 (GRCm39) missense probably damaging 1.00
R7955:Mocos UTSW 18 24,799,216 (GRCm39) missense probably damaging 1.00
R8458:Mocos UTSW 18 24,799,314 (GRCm39) missense probably benign 0.00
R8762:Mocos UTSW 18 24,812,554 (GRCm39) missense probably damaging 0.99
R9072:Mocos UTSW 18 24,797,089 (GRCm39) missense probably damaging 0.98
R9073:Mocos UTSW 18 24,797,089 (GRCm39) missense probably damaging 0.98
R9192:Mocos UTSW 18 24,812,594 (GRCm39) missense probably benign 0.00
R9781:Mocos UTSW 18 24,828,939 (GRCm39) missense probably benign 0.02
Z1176:Mocos UTSW 18 24,803,690 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATCGCCTGCCTTGCTCAC -3'
(R):5'- AGAGAAGTCAGGCTGGTCTC -3'

Sequencing Primer
(F):5'- TCACTTCCCGGGCTGGAC -3'
(R):5'- CAAGAAGTCTTGCTACTGCGG -3'
Posted On 2016-06-21