Incidental Mutation 'R5162:Bcor'
ID397082
Institutional Source Beutler Lab
Gene Symbol Bcor
Ensembl Gene ENSMUSG00000040363
Gene NameBCL6 interacting corepressor
Synonyms5830466J11Rik, D930024N20Rik, 8430401K06Rik
MMRRC Submission 042744-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R5162 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location12036740-12160355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12040486 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1551 (R1551Q)
Ref Sequence ENSEMBL: ENSMUSP00000111175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043441] [ENSMUST00000065143] [ENSMUST00000115512] [ENSMUST00000115513] [ENSMUST00000124033]
Predicted Effect probably damaging
Transcript: ENSMUST00000043441
AA Change: R1499Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048024
Gene: ENSMUSG00000040363
AA Change: R1499Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000065143
AA Change: R1517Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068618
Gene: ENSMUSG00000040363
AA Change: R1517Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
ANK 1432 1462 1.6e1 SMART
ANK 1466 1495 8.26e-2 SMART
ANK 1499 1528 3.06e-5 SMART
low complexity region 1590 1601 N/A INTRINSIC
PDB:4HPL|A 1602 1718 2e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115512
AA Change: R1533Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111174
Gene: ENSMUSG00000040363
AA Change: R1533Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1408 1421 N/A INTRINSIC
ANK 1448 1478 1.6e1 SMART
ANK 1482 1511 8.26e-2 SMART
ANK 1515 1544 3.06e-5 SMART
low complexity region 1606 1617 N/A INTRINSIC
PDB:4HPL|A 1618 1734 2e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115513
AA Change: R1551Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111175
Gene: ENSMUSG00000040363
AA Change: R1551Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
Pfam:BCOR 1205 1417 1.6e-77 PFAM
low complexity region 1426 1439 N/A INTRINSIC
ANK 1466 1496 1.6e1 SMART
ANK 1500 1529 8.26e-2 SMART
ANK 1533 1562 3.06e-5 SMART
low complexity region 1624 1635 N/A INTRINSIC
Pfam:PUFD 1638 1751 5.6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124033
AA Change: R1499Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116258
Gene: ENSMUSG00000040363
AA Change: R1499Q

DomainStartEndE-ValueType
low complexity region 330 342 N/A INTRINSIC
low complexity region 552 580 N/A INTRINSIC
low complexity region 1374 1387 N/A INTRINSIC
ANK 1414 1444 1.6e1 SMART
ANK 1448 1477 8.26e-2 SMART
ANK 1481 1510 3.06e-5 SMART
low complexity region 1572 1583 N/A INTRINSIC
PDB:4HPL|A 1584 1700 1e-67 PDB
Meta Mutation Damage Score 0.2695 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010]
PHENOTYPE: Male chimeras hemizygous for either of two different gene trapped alleles die by E9.5 exhibiting anomalies in somite formation and heart looping, forebrain fusion, and microcephaly. Hemizygosity for other gene trapped alleles can cause patterning and embryo turning defects or abnormal gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,293,671 T229S probably benign Het
Adrb3 T C 8: 27,227,320 E367G probably benign Het
Ak9 T A 10: 41,357,657 N630K probably damaging Het
Atp8b1 T C 18: 64,561,662 I516M possibly damaging Het
Cry1 T A 10: 85,133,286 H558L probably benign Het
Cyp3a57 T A 5: 145,369,083 W126R probably damaging Het
Dhx36 A T 3: 62,493,780 V355E probably damaging Het
Diexf G T 1: 193,113,781 T192K probably damaging Het
Dpp6 A G 5: 27,399,015 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 T C 15: 54,847,296 D694G probably benign Het
Esrp2 T C 8: 106,133,298 E336G probably damaging Het
Faah A T 4: 116,000,741 probably benign Het
Fat1 G A 8: 45,025,809 G2608R probably benign Het
Fbxo8 A T 8: 56,569,319 Y122F probably damaging Het
Fgd5 A G 6: 92,074,234 D1497G probably damaging Het
Fn3krp T C 11: 121,429,584 F252L probably damaging Het
Fnip2 T C 3: 79,481,777 Y549C probably damaging Het
Gcm2 T C 13: 41,103,655 N206S probably benign Het
Gm4758 A T 16: 36,312,556 H65L probably damaging Het
Grn C A 11: 102,430,554 probably benign Het
H2-T10 T A 17: 36,118,951 probably null Het
Henmt1 T C 3: 108,940,050 probably null Het
Man1b1 T A 2: 25,343,353 L246Q probably damaging Het
Mdh2 T C 5: 135,783,475 probably null Het
Mocos T C 18: 24,654,052 F43L probably damaging Het
Mpp6 T A 6: 50,178,515 W259R probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Naip5 T A 13: 100,223,406 I441F possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nars2 T C 7: 97,059,820 probably benign Het
Ncoa2 A T 1: 13,175,172 M434K possibly damaging Het
Nlrp4g T A 9: 124,350,394 noncoding transcript Het
Olfr459 G T 6: 41,771,772 H176N possibly damaging Het
Olfr761 T A 17: 37,952,364 Q220L probably benign Het
Pars2 A G 4: 106,654,538 T506A probably benign Het
Pkp2 T C 16: 16,260,336 S481P probably damaging Het
Plod3 T C 5: 136,991,307 W459R probably damaging Het
Pramef12 A T 4: 144,394,912 L181M probably damaging Het
Prdm10 A T 9: 31,340,418 I361F possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raver2 T C 4: 101,102,724 C134R probably damaging Het
Rnf130 G C 11: 50,052,895 A123P probably damaging Het
Slc29a4 G A 5: 142,721,452 A517T possibly damaging Het
Slc38a6 T A 12: 73,329,985 S138T possibly damaging Het
Spred1 T C 2: 117,177,621 V336A possibly damaging Het
Sptlc3 T A 2: 139,631,343 M504K probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Trim23 C T 13: 104,181,174 T61I probably damaging Het
Tsg101 T C 7: 46,892,426 T260A probably damaging Het
Tyw5 T C 1: 57,401,459 Y48C probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Vmn2r89 C A 14: 51,456,163 H323Q possibly damaging Het
Vps18 A G 2: 119,292,942 S117G probably benign Het
Zfp93 C G 7: 24,276,332 Q581E probably damaging Het
Other mutations in Bcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Bcor APN X 12037820 missense probably damaging 0.99
IGL02034:Bcor APN X 12039259 missense possibly damaging 0.46
IGL02458:Bcor APN X 12048510 missense probably damaging 1.00
IGL03330:Bcor APN X 12058871 missense possibly damaging 0.65
R0648:Bcor UTSW X 12059051 missense probably damaging 1.00
R2147:Bcor UTSW X 12057623 missense possibly damaging 0.73
R2148:Bcor UTSW X 12057623 missense possibly damaging 0.73
R4941:Bcor UTSW X 12040486 missense probably damaging 1.00
R5004:Bcor UTSW X 12040486 missense probably damaging 1.00
R5163:Bcor UTSW X 12040486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCGAAACCATACTGTGC -3'
(R):5'- AGATGTGTACTTGAGAGCTGACC -3'

Sequencing Primer
(F):5'- GCACAGGTGAGTCAAACTTTTG -3'
(R):5'- CCCTTCACTGGTACTTTAGAAGAGAG -3'
Posted On2016-06-21