Incidental Mutation 'R5163:Gltp'
ID397094
Institutional Source Beutler Lab
Gene Symbol Gltp
Ensembl Gene ENSMUSG00000011884
Gene Nameglycolipid transfer protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114669398-114690984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114674061 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 147 (I147T)
Ref Sequence ENSEMBL: ENSMUSP00000012028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012028] [ENSMUST00000112212] [ENSMUST00000112214]
Predicted Effect probably benign
Transcript: ENSMUST00000012028
AA Change: I147T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000012028
Gene: ENSMUSG00000011884
AA Change: I147T

DomainStartEndE-ValueType
Pfam:GLTP 16 169 4.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112212
AA Change: I128T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107831
Gene: ENSMUSG00000011884
AA Change: I128T

DomainStartEndE-ValueType
Pfam:GLTP 16 83 6e-18 PFAM
Pfam:GLTP 79 150 3.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112214
AA Change: I117T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107833
Gene: ENSMUSG00000011884
AA Change: I117T

DomainStartEndE-ValueType
Pfam:GLTP 16 80 2.1e-16 PFAM
Pfam:GLTP 72 139 9.4e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to bovine and porcine proteins which accelerate transfer of certain glycosphingolipids and glyceroglycolipids between membranes. It is thought to be a cytoplasmic protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Gltp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02987:Gltp APN 5 114674182 missense probably benign 0.32
R4621:Gltp UTSW 5 114674127 missense probably damaging 0.99
R6328:Gltp UTSW 5 114670511 missense possibly damaging 0.60
R7514:Gltp UTSW 5 114670460 missense probably benign 0.00
R7819:Gltp UTSW 5 114674100 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGAGTCTCTTCTCACAGCCG -3'
(R):5'- GCTGTAGTGAGCCATGGTTC -3'

Sequencing Primer
(F):5'- TTCTCACAGCCGTGGAAC -3'
(R):5'- CCATGGTTCTGAATGGCTGTCC -3'
Posted On2016-06-21