Incidental Mutation 'R5163:Zfp936'
ID397101
Institutional Source Beutler Lab
Gene Symbol Zfp936
Ensembl Gene ENSMUSG00000064194
Gene Namezinc finger protein 936
SynonymsEG435970, Gm9272, I1C0022H11Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R5163 (G1)
Quality Score161
Status Not validated
Chromosome7
Chromosomal Location43114229-43192109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43190240 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 377 (Q377R)
Ref Sequence ENSEMBL: ENSMUSP00000143800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072829] [ENSMUST00000200973] [ENSMUST00000202535] [ENSMUST00000205912]
Predicted Effect probably benign
Transcript: ENSMUST00000072829
AA Change: Q376R

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072608
Gene: ENSMUSG00000064194
AA Change: Q376R

DomainStartEndE-ValueType
KRAB 3 65 5.32e-19 SMART
ZnF_C2H2 148 170 5.9e-3 SMART
ZnF_C2H2 176 198 5.9e-3 SMART
ZnF_C2H2 204 226 1.4e-4 SMART
ZnF_C2H2 232 254 1.2e-3 SMART
ZnF_C2H2 260 282 7.37e-4 SMART
ZnF_C2H2 288 310 2.27e-4 SMART
ZnF_C2H2 316 338 2.09e-3 SMART
ZnF_C2H2 344 366 1.45e-2 SMART
ZnF_C2H2 372 394 1.82e-3 SMART
ZnF_C2H2 400 422 2.53e-2 SMART
ZnF_C2H2 428 450 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200973
SMART Domains Protein: ENSMUSP00000144191
Gene: ENSMUSG00000064194

DomainStartEndE-ValueType
KRAB 4 66 1.4e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202535
AA Change: Q377R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143800
Gene: ENSMUSG00000064194
AA Change: Q377R

DomainStartEndE-ValueType
KRAB 4 66 2.3e-21 SMART
ZnF_C2H2 149 171 2.6e-5 SMART
ZnF_C2H2 177 199 2.5e-5 SMART
ZnF_C2H2 205 227 5.9e-7 SMART
ZnF_C2H2 233 255 5.1e-6 SMART
ZnF_C2H2 261 283 3.1e-6 SMART
ZnF_C2H2 289 311 9.4e-7 SMART
ZnF_C2H2 317 339 8.7e-6 SMART
ZnF_C2H2 345 367 6.3e-5 SMART
ZnF_C2H2 373 395 7.7e-6 SMART
ZnF_C2H2 401 423 1.1e-4 SMART
ZnF_C2H2 429 451 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205912
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Zfp936
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:Zfp936 APN 7 43187485 splice site probably null
IGL02245:Zfp936 APN 7 43187298 critical splice donor site probably null
IGL02335:Zfp936 APN 7 43187267 missense probably damaging 1.00
FR4340:Zfp936 UTSW 7 43189489 missense possibly damaging 0.63
R0437:Zfp936 UTSW 7 43189310 missense probably benign 0.00
R3899:Zfp936 UTSW 7 43189734 missense possibly damaging 0.93
R4120:Zfp936 UTSW 7 43190206 missense probably benign 0.10
R4406:Zfp936 UTSW 7 43190324 missense possibly damaging 0.82
R4959:Zfp936 UTSW 7 43189610 missense probably damaging 1.00
R5023:Zfp936 UTSW 7 43187257 missense probably damaging 1.00
R5182:Zfp936 UTSW 7 43189907 missense probably damaging 1.00
R5292:Zfp936 UTSW 7 43189335 nonsense probably null
R5668:Zfp936 UTSW 7 43190434 missense possibly damaging 0.93
R6057:Zfp936 UTSW 7 43190363 missense probably benign 0.00
R6901:Zfp936 UTSW 7 43190043 missense probably damaging 1.00
R7139:Zfp936 UTSW 7 43190291 missense possibly damaging 0.54
R7258:Zfp936 UTSW 7 43190379 missense probably damaging 1.00
R7440:Zfp936 UTSW 7 43187261 missense probably damaging 1.00
R7537:Zfp936 UTSW 7 43189815 nonsense probably null
R7561:Zfp936 UTSW 7 43189915 missense probably damaging 0.98
R7662:Zfp936 UTSW 7 43189912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCTTTTCACACCAGAGTAAT -3'
(R):5'- TGAATAGGCTTCATCACATTGGT -3'

Sequencing Primer
(F):5'- GTGATAAAGCCTTTTCACACCAGAG -3'
(R):5'- GACTGCGTTGTGTAAAAGCCTTACC -3'
Posted On2016-06-21