Incidental Mutation 'R5163:Zkscan2'
ID397103
Institutional Source Beutler Lab
Gene Symbol Zkscan2
Ensembl Gene ENSMUSG00000030757
Gene Namezinc finger with KRAB and SCAN domains 2
Synonyms9430065N20Rik, Zfp694
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location123475384-123500449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123499867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 34 (E34G)
Ref Sequence ENSEMBL: ENSMUSP00000134381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042470] [ENSMUST00000128217]
Predicted Effect probably benign
Transcript: ENSMUST00000042470
AA Change: E34G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041821
Gene: ENSMUSG00000030757
AA Change: E34G

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
KRAB 222 282 1.71e-2 SMART
SANT 333 397 3.73e0 SMART
low complexity region 449 469 N/A INTRINSIC
SANT 489 553 2.18e0 SMART
low complexity region 627 649 N/A INTRINSIC
ZnF_C2H2 768 790 6.42e-4 SMART
ZnF_C2H2 796 818 7.9e-4 SMART
ZnF_C2H2 824 846 5.99e-4 SMART
ZnF_C2H2 852 874 3.21e-4 SMART
ZnF_C2H2 880 902 1.18e-2 SMART
ZnF_C2H2 908 930 8.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128217
AA Change: E34G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134381
Gene: ENSMUSG00000030757
AA Change: E34G

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Zkscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zkscan2 APN 7 123479972 missense probably damaging 1.00
IGL02098:Zkscan2 APN 7 123499841 missense probably benign 0.02
IGL03093:Zkscan2 APN 7 123494850 missense probably benign 0.01
R0016:Zkscan2 UTSW 7 123499996 start gained probably benign
R0135:Zkscan2 UTSW 7 123480641 missense possibly damaging 0.63
R0541:Zkscan2 UTSW 7 123480200 missense possibly damaging 0.92
R0569:Zkscan2 UTSW 7 123498675 missense probably benign 0.11
R1537:Zkscan2 UTSW 7 123499841 missense possibly damaging 0.95
R1726:Zkscan2 UTSW 7 123489823 missense probably damaging 1.00
R3792:Zkscan2 UTSW 7 123485002 missense possibly damaging 0.95
R3802:Zkscan2 UTSW 7 123495142 intron probably benign
R3803:Zkscan2 UTSW 7 123495142 intron probably benign
R3804:Zkscan2 UTSW 7 123495142 intron probably benign
R4012:Zkscan2 UTSW 7 123498660 missense possibly damaging 0.76
R4111:Zkscan2 UTSW 7 123482684 intron probably benign
R4605:Zkscan2 UTSW 7 123498724 missense probably damaging 1.00
R4978:Zkscan2 UTSW 7 123495319 missense possibly damaging 0.86
R5004:Zkscan2 UTSW 7 123490044 missense probably damaging 1.00
R5753:Zkscan2 UTSW 7 123480700 missense probably benign
R5830:Zkscan2 UTSW 7 123480100 missense possibly damaging 0.47
R6153:Zkscan2 UTSW 7 123489770 missense probably benign 0.06
R6912:Zkscan2 UTSW 7 123499973 start gained probably benign
R7170:Zkscan2 UTSW 7 123499807 missense possibly damaging 0.83
R7269:Zkscan2 UTSW 7 123489771 missense probably benign
R7310:Zkscan2 UTSW 7 123490053 missense possibly damaging 0.53
R7399:Zkscan2 UTSW 7 123480104 missense probably damaging 0.98
R7624:Zkscan2 UTSW 7 123498771 missense probably damaging 0.97
R7687:Zkscan2 UTSW 7 123499862 missense probably benign 0.13
Z1177:Zkscan2 UTSW 7 123480358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCAGCTGCTCGAGGATC -3'
(R):5'- GAGTTCCTTGTCCCAGCTAAC -3'

Sequencing Primer
(F):5'- CAGCTGCTCGAGGATCTGTTC -3'
(R):5'- ACGGTCCCATATTTCCAAGGG -3'
Posted On2016-06-21