Incidental Mutation 'R5163:Ucp1'
ID 397104
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Name uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms Slc25a7
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5163 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 84016981-84025081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84020832 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 183 (R183G)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
AlphaFold P12242
Predicted Effect possibly damaging
Transcript: ENSMUST00000034146
AA Change: R183G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: R183G

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Bcor C T X: 11,906,725 (GRCm39) R1551Q probably damaging Het
Btbd19 T G 4: 116,978,628 (GRCm39) I152L probably damaging Het
Dnaaf11 T C 15: 66,314,067 (GRCm39) D311G probably benign Het
Dync2i1 C T 12: 116,219,486 (GRCm39) R152H possibly damaging Het
Ercc6l2 A G 13: 64,046,845 (GRCm39) probably benign Het
Fat4 A G 3: 39,034,946 (GRCm39) D2866G probably damaging Het
Fkbp10 C T 11: 100,313,925 (GRCm39) A311V probably benign Het
Fnbp1l T C 3: 122,338,312 (GRCm39) N511S probably benign Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gltp A G 5: 114,812,122 (GRCm39) I147T probably benign Het
Gpr37 A T 6: 25,669,614 (GRCm39) I410N possibly damaging Het
Hivep2 G A 10: 14,015,169 (GRCm39) G1779R probably damaging Het
Ifna14 T C 4: 88,489,599 (GRCm39) Y146C probably damaging Het
Loxhd1 A G 18: 77,449,432 (GRCm39) D662G possibly damaging Het
Lrrc9 A T 12: 72,496,163 (GRCm39) I13F probably damaging Het
Map2k3 T A 11: 60,834,317 (GRCm39) I95N probably damaging Het
Mark1 A G 1: 184,637,807 (GRCm39) I594T probably damaging Het
Mettl14 T C 3: 123,168,474 (GRCm39) I189V possibly damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Odf4 C A 11: 68,813,672 (GRCm39) C133F probably damaging Het
Opa1 A T 16: 29,416,438 (GRCm39) Q106L probably damaging Het
Or10d5j T C 9: 39,868,216 (GRCm39) N5S probably damaging Het
Pax4 T G 6: 28,446,269 (GRCm39) S75R probably damaging Het
Ppfibp1 T A 6: 146,923,629 (GRCm39) probably null Het
Ptpn20 T C 14: 33,353,068 (GRCm39) I269T probably benign Het
Ptprq T C 10: 107,360,192 (GRCm39) Q2161R probably damaging Het
Rab22a A G 2: 173,503,280 (GRCm39) D31G probably damaging Het
Rap1gds1 A T 3: 138,664,817 (GRCm39) M296K probably damaging Het
Rfx1 A G 8: 84,819,840 (GRCm39) T692A probably damaging Het
Sf3b2 A G 19: 5,325,165 (GRCm39) V769A probably damaging Het
Skint5 A T 4: 113,652,762 (GRCm39) F621I unknown Het
Spink5 A C 18: 44,132,924 (GRCm39) R513S possibly damaging Het
Srrm2 C T 17: 24,038,524 (GRCm39) probably benign Het
Srrt A G 5: 137,295,035 (GRCm39) probably null Het
Sun3 T C 11: 8,973,295 (GRCm39) Q134R possibly damaging Het
Tpo A G 12: 30,155,979 (GRCm39) V174A probably benign Het
Vmn2r66 A G 7: 84,656,017 (GRCm39) V333A probably benign Het
Zfp108 G T 7: 23,960,163 (GRCm39) K251N probably benign Het
Zfp936 A G 7: 42,839,664 (GRCm39) Q377R probably damaging Het
Zkscan2 T C 7: 123,099,090 (GRCm39) E34G probably benign Het
Zup1 T A 10: 33,825,439 (GRCm39) E14D probably damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 84,020,577 (GRCm39) missense probably damaging 1.00
R0050:Ucp1 UTSW 8 84,020,857 (GRCm39) missense probably damaging 1.00
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0505:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 84,018,232 (GRCm39) splice site probably benign
R0681:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 84,024,476 (GRCm39) splice site probably benign
R1606:Ucp1 UTSW 8 84,021,933 (GRCm39) missense probably damaging 1.00
R1722:Ucp1 UTSW 8 84,017,317 (GRCm39) missense probably benign 0.25
R1809:Ucp1 UTSW 8 84,024,496 (GRCm39) missense probably damaging 0.99
R1823:Ucp1 UTSW 8 84,020,661 (GRCm39) missense probably damaging 1.00
R3809:Ucp1 UTSW 8 84,017,270 (GRCm39) missense probably damaging 0.99
R4085:Ucp1 UTSW 8 84,020,580 (GRCm39) missense probably benign 0.43
R4673:Ucp1 UTSW 8 84,021,876 (GRCm39) missense probably damaging 1.00
R4998:Ucp1 UTSW 8 84,024,484 (GRCm39) critical splice acceptor site probably null
R5421:Ucp1 UTSW 8 84,017,320 (GRCm39) missense probably benign 0.12
R5790:Ucp1 UTSW 8 84,024,520 (GRCm39) missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 84,020,567 (GRCm39) missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 84,020,718 (GRCm39) critical splice donor site probably null
R6732:Ucp1 UTSW 8 84,018,106 (GRCm39) missense probably benign 0.08
R7282:Ucp1 UTSW 8 84,020,531 (GRCm39) missense probably benign 0.03
R7343:Ucp1 UTSW 8 84,021,881 (GRCm39) missense probably damaging 0.99
R7878:Ucp1 UTSW 8 84,024,521 (GRCm39) missense probably benign 0.19
R8008:Ucp1 UTSW 8 84,020,640 (GRCm39) missense probably benign 0.32
R8365:Ucp1 UTSW 8 84,020,628 (GRCm39) missense probably damaging 0.97
R8899:Ucp1 UTSW 8 84,017,216 (GRCm39) missense probably benign 0.35
R9186:Ucp1 UTSW 8 84,017,272 (GRCm39) nonsense probably null
R9499:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9551:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9552:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTGCATGGGATCAAACCC -3'
(R):5'- TGGGATACACTTTTAACCCAGC -3'

Sequencing Primer
(F):5'- GGGATCAAACCCCGCTAC -3'
(R):5'- CAGAGTGATCAGCCTGGTCTATAC -3'
Posted On 2016-06-21