Incidental Mutation 'R5163:Zufsp'
ID397108
Institutional Source Beutler Lab
Gene Symbol Zufsp
Ensembl Gene ENSMUSG00000039531
Gene Namezinc finger with UFM1-specific peptidase domain
Synonyms2700019D07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location33919142-33951269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33949443 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 14 (E14D)
Ref Sequence ENSEMBL: ENSMUSP00000151477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048222] [ENSMUST00000218055] [ENSMUST00000218222] [ENSMUST00000218275] [ENSMUST00000218880] [ENSMUST00000218892] [ENSMUST00000219457] [ENSMUST00000219878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048222
AA Change: E14D

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037121
Gene: ENSMUSG00000039531
AA Change: E14D

DomainStartEndE-ValueType
ZnF_C2H2 2 24 5.42e-2 SMART
ZnF_C2H2 29 52 1.13e1 SMART
ZnF_C2H2 153 176 2.47e1 SMART
ZnF_C2H2 192 214 6.23e-2 SMART
coiled coil region 236 267 N/A INTRINSIC
Pfam:Peptidase_C78 334 550 1.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218055
AA Change: E14D

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000218222
AA Change: E14D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218275
AA Change: E14D

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000218880
AA Change: E14D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218892
AA Change: E14D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219457
AA Change: E14D

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000219878
AA Change: E14D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Other mutations in Zufsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02510:Zufsp APN 10 33930154 critical splice donor site probably null
IGL02586:Zufsp APN 10 33935265 intron probably benign
IGL03350:Zufsp APN 10 33928111 missense probably benign 0.04
R0145:Zufsp UTSW 10 33943713 missense probably damaging 0.96
R1156:Zufsp UTSW 10 33949226 missense probably benign 0.15
R1523:Zufsp UTSW 10 33927440 missense probably damaging 1.00
R1769:Zufsp UTSW 10 33935176 missense probably damaging 1.00
R1802:Zufsp UTSW 10 33943718 missense probably damaging 0.98
R2013:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2014:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2015:Zufsp UTSW 10 33929824 missense possibly damaging 0.75
R2017:Zufsp UTSW 10 33927464 missense possibly damaging 0.46
R2342:Zufsp UTSW 10 33928117 missense probably damaging 1.00
R2901:Zufsp UTSW 10 33927612 missense probably damaging 1.00
R2901:Zufsp UTSW 10 33928063 missense probably benign
R3813:Zufsp UTSW 10 33940222 missense possibly damaging 0.63
R4488:Zufsp UTSW 10 33948964 missense probably damaging 1.00
R4674:Zufsp UTSW 10 33948984 missense possibly damaging 0.92
R4883:Zufsp UTSW 10 33949042 missense probably damaging 0.98
R4926:Zufsp UTSW 10 33949438 missense probably damaging 1.00
R5373:Zufsp UTSW 10 33927466 missense possibly damaging 0.46
R5374:Zufsp UTSW 10 33927466 missense possibly damaging 0.46
R5924:Zufsp UTSW 10 33927547 missense probably damaging 0.96
R5929:Zufsp UTSW 10 33949047 nonsense probably null
R5941:Zufsp UTSW 10 33949462 missense probably damaging 1.00
R6337:Zufsp UTSW 10 33949256 missense probably benign 0.00
R6663:Zufsp UTSW 10 33949435 missense possibly damaging 0.86
R6753:Zufsp UTSW 10 33928029 missense probably damaging 1.00
R7690:Zufsp UTSW 10 33930155 critical splice donor site probably null
X0063:Zufsp UTSW 10 33943687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTGCACTGCAGCTAGCTTC -3'
(R):5'- CCTGTAGCTAGGCTTTCTTAGGAC -3'

Sequencing Primer
(F):5'- ACTGCAGCTAGCTTCTCAGAG -3'
(R):5'- CAGTGAATTTTTCTTTGCCAAAGC -3'
Posted On2016-06-21