Incidental Mutation 'R5163:Map2k3'
ID397110
Institutional Source Beutler Lab
Gene Symbol Map2k3
Ensembl Gene ENSMUSG00000018932
Gene Namemitogen-activated protein kinase kinase 3
SynonymsMKK3, Prkmk3, MAP kinase kinase 3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60932033-60952811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60943491 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 95 (I95N)
Ref Sequence ENSEMBL: ENSMUSP00000114430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019076] [ENSMUST00000130269]
Predicted Effect probably damaging
Transcript: ENSMUST00000019076
AA Change: I95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019076
Gene: ENSMUSG00000018932
AA Change: I95N

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
S_TKc 64 325 1.41e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126043
Predicted Effect probably damaging
Transcript: ENSMUST00000130269
AA Change: I95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114430
Gene: ENSMUSG00000018932
AA Change: I95N

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Pkinase 64 173 1.3e-12 PFAM
Pfam:Pkinase_Tyr 64 173 3.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145828
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but display abnormalities in cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Map2k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Map2k3 APN 11 60943215 missense possibly damaging 0.54
IGL00901:Map2k3 APN 11 60941921 missense probably benign 0.00
IGL01620:Map2k3 APN 11 60950047 missense possibly damaging 0.86
IGL02197:Map2k3 APN 11 60946764 missense probably damaging 1.00
R1907:Map2k3 UTSW 11 60932229 missense possibly damaging 0.70
R2069:Map2k3 UTSW 11 60950027 missense probably damaging 1.00
R4447:Map2k3 UTSW 11 60947171 missense probably damaging 1.00
R5106:Map2k3 UTSW 11 60941882 missense probably damaging 0.97
R6043:Map2k3 UTSW 11 60946746 missense probably benign 0.01
R6147:Map2k3 UTSW 11 60949950 nonsense probably null
R6659:Map2k3 UTSW 11 60942324 missense probably benign 0.45
R7206:Map2k3 UTSW 11 60943580 missense
R7261:Map2k3 UTSW 11 60945567 splice site probably null
R7389:Map2k3 UTSW 11 60932036 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCACCCTACCTGGAGTAGCAC -3'
(R):5'- CGGGAACTCCACACAATAGG -3'

Sequencing Primer
(F):5'- CTACCTGGAGTAGCACTGGAG -3'
(R):5'- TCCACACAATAGGACTGAAATGG -3'
Posted On2016-06-21