Incidental Mutation 'R5163:Odf4'
ID397111
Institutional Source Beutler Lab
Gene Symbol Odf4
Ensembl Gene ENSMUSG00000032921
Gene Nameouter dense fiber of sperm tails 4
SynonymsOppo1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68921835-68927081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68922846 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 133 (C133F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038932] [ENSMUST00000125134] [ENSMUST00000130271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038932
AA Change: C172F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040050
Gene: ENSMUSG00000032921
AA Change: C172F

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 42 222 1.1e-8 PFAM
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125134
AA Change: C171F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133636
Gene: ENSMUSG00000032921
AA Change: C171F

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130271
AA Change: C172F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134383
Gene: ENSMUSG00000032921
AA Change: C172F

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156828
AA Change: C133F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133569
Gene: ENSMUSG00000032921
AA Change: C133F

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the outer dense fibers of the tails of mature sperm. This protein is thought to have some important role in the sperm tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Odf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Odf4 APN 11 68921952 unclassified probably benign
IGL01782:Odf4 APN 11 68926633 missense probably damaging 0.98
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R1945:Odf4 UTSW 11 68922157 missense possibly damaging 0.53
R4551:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4552:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4685:Odf4 UTSW 11 68922839 critical splice donor site probably null
R4707:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R6657:Odf4 UTSW 11 68926812 missense probably benign 0.12
R7073:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R7508:Odf4 UTSW 11 68922423 missense possibly damaging 0.71
X0025:Odf4 UTSW 11 68926790 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCTAAGAATTGCACAGGGG -3'
(R):5'- CCCCAGACAATTTTAAGATGTGG -3'

Sequencing Primer
(F):5'- TCATCTGCCGAGCCTACAG -3'
(R):5'- GGACAATCCATCCAGTTTTTGG -3'
Posted On2016-06-21