Incidental Mutation 'R5163:Ercc6l2'
ID397119
Institutional Source Beutler Lab
Gene Symbol Ercc6l2
Ensembl Gene ENSMUSG00000021470
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms0610007P08Rik, 1700019D06Rik, 9330134C04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location63815240-63900302 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 63899031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095724]
Predicted Effect probably benign
Transcript: ENSMUST00000095724
SMART Domains Protein: ENSMUSP00000093392
Gene: ENSMUSG00000021470

DomainStartEndE-ValueType
DEXDc 1 183 2.72e-14 SMART
Blast:DEXDc 232 277 3e-13 BLAST
HELICc 388 471 3.12e-23 SMART
low complexity region 817 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222300
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Ercc6l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Ercc6l2 APN 13 63858319 missense probably damaging 0.99
IGL00678:Ercc6l2 APN 13 63844613 missense probably damaging 1.00
IGL00765:Ercc6l2 APN 13 63848772 missense possibly damaging 0.95
IGL01062:Ercc6l2 APN 13 63847454 missense probably null 1.00
IGL01655:Ercc6l2 APN 13 63819752 nonsense probably null
IGL02175:Ercc6l2 APN 13 63869190 utr 3 prime probably benign
IGL02201:Ercc6l2 APN 13 63852969 missense probably benign 0.12
IGL02351:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02358:Ercc6l2 APN 13 63853683 missense probably damaging 1.00
IGL02622:Ercc6l2 APN 13 63853623 unclassified probably null
PIT4812001:Ercc6l2 UTSW 13 63858257 missense possibly damaging 0.58
R0142:Ercc6l2 UTSW 13 63872506 unclassified probably benign
R0648:Ercc6l2 UTSW 13 63844645 missense probably benign 0.04
R1136:Ercc6l2 UTSW 13 63869120 missense possibly damaging 0.75
R1536:Ercc6l2 UTSW 13 63824871 missense possibly damaging 0.81
R1706:Ercc6l2 UTSW 13 63872458 unclassified probably benign
R2108:Ercc6l2 UTSW 13 63871988 unclassified probably benign
R2111:Ercc6l2 UTSW 13 63834749 missense probably damaging 1.00
R2126:Ercc6l2 UTSW 13 63848771 missense probably damaging 1.00
R2154:Ercc6l2 UTSW 13 63866007 missense probably damaging 1.00
R3551:Ercc6l2 UTSW 13 63844595 missense probably damaging 1.00
R3773:Ercc6l2 UTSW 13 63841450 missense probably damaging 1.00
R3923:Ercc6l2 UTSW 13 63870735 unclassified probably benign
R4233:Ercc6l2 UTSW 13 63872168 unclassified probably benign
R4782:Ercc6l2 UTSW 13 63834738 missense probably damaging 1.00
R4928:Ercc6l2 UTSW 13 63894813 utr 3 prime probably benign
R5268:Ercc6l2 UTSW 13 63869111 missense possibly damaging 0.92
R5423:Ercc6l2 UTSW 13 63872258 unclassified probably benign
R6128:Ercc6l2 UTSW 13 63853749 missense probably damaging 0.98
R6164:Ercc6l2 UTSW 13 63872344 unclassified probably benign
R7238:Ercc6l2 UTSW 13 63865984 missense probably damaging 0.98
R7295:Ercc6l2 UTSW 13 63819775 missense probably damaging 0.96
R7708:Ercc6l2 UTSW 13 63841514 nonsense probably null
RF013:Ercc6l2 UTSW 13 63853017 missense probably benign 0.06
Z1088:Ercc6l2 UTSW 13 63853728 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGAAAATCAGTCAGATCTCAGAATC -3'
(R):5'- TTTTGCCACAGGTCCTGAAAG -3'

Sequencing Primer
(F):5'- GTCAGATCTCAGAATCATGTTTTCC -3'
(R):5'- CCCCGTGGCTTTTAAAGAGGTC -3'
Posted On2016-06-21