Incidental Mutation 'R5163:Opa1'
ID397123
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene NameOPA1, mitochondrial dynamin like GTPase
Synonyms1200011N24Rik, lilr3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location29579334-29654884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29597620 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 106 (Q106L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
Predicted Effect probably benign
Transcript: ENSMUST00000038867
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160153
Predicted Effect probably benign
Transcript: ENSMUST00000160475
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160597
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161186
AA Change: Q220L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: Q220L

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162240
AA Change: Q106L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124029
Gene: ENSMUSG00000038084
AA Change: Q106L

DomainStartEndE-ValueType
low complexity region 58 74 N/A INTRINSIC
coiled coil region 93 176 N/A INTRINSIC
Pfam:Dynamin_N 215 296 5.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Sf3b2 A G 19: 5,275,137 V769A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29618115 splice site probably benign
IGL01087:Opa1 APN 16 29586997 missense probably damaging 1.00
IGL01799:Opa1 APN 16 29616658 missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29586995 missense probably benign 0.35
IGL02067:Opa1 APN 16 29616655 missense probably damaging 1.00
IGL02317:Opa1 APN 16 29615166 critical splice donor site probably null
IGL02567:Opa1 APN 16 29588286 missense probably benign 0.01
IGL02826:Opa1 APN 16 29610887 missense probably null
Longshanks UTSW 16 29618259 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0092:Opa1 UTSW 16 29625594 missense probably damaging 0.99
R0114:Opa1 UTSW 16 29629635 missense probably benign 0.35
R0200:Opa1 UTSW 16 29614129 missense probably benign 0.08
R0308:Opa1 UTSW 16 29621531 missense probably damaging 0.98
R0427:Opa1 UTSW 16 29611461 missense probably damaging 0.98
R0671:Opa1 UTSW 16 29602207 splice site probably benign
R1768:Opa1 UTSW 16 29620810 missense probably benign
R1889:Opa1 UTSW 16 29625585 missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R3933:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R4434:Opa1 UTSW 16 29611983 missense probably damaging 1.00
R4618:Opa1 UTSW 16 29587039 missense probably damaging 1.00
R4926:Opa1 UTSW 16 29648973 missense possibly damaging 0.94
R5249:Opa1 UTSW 16 29618259 missense probably damaging 1.00
R5266:Opa1 UTSW 16 29618130 missense probably benign 0.19
R5275:Opa1 UTSW 16 29611579 missense probably damaging 1.00
R5372:Opa1 UTSW 16 29586119 missense probably benign 0.00
R5990:Opa1 UTSW 16 29587018 missense probably damaging 0.99
R6054:Opa1 UTSW 16 29615134 missense probably damaging 1.00
R6483:Opa1 UTSW 16 29628707 missense possibly damaging 0.72
R6522:Opa1 UTSW 16 29625514 missense probably benign 0.06
R6889:Opa1 UTSW 16 29620868 missense probably benign 0.22
R7225:Opa1 UTSW 16 29614039 splice site probably null
R7243:Opa1 UTSW 16 29586996 missense probably benign 0.01
R7324:Opa1 UTSW 16 29586981 missense probably benign
R7831:Opa1 UTSW 16 29648937 missense probably benign 0.02
R7914:Opa1 UTSW 16 29648937 missense probably benign 0.02
RF012:Opa1 UTSW 16 29613966 missense probably damaging 1.00
T0722:Opa1 UTSW 16 29610930 critical splice donor site probably null
X0065:Opa1 UTSW 16 29620784 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCTGAGACACCCAGTTTTACTG -3'
(R):5'- AATGACTGGAGTCCACCAACAG -3'

Sequencing Primer
(F):5'- AGTGCAGAGCCCACTTGTG -3'
(R):5'- TCCACCAACAGATTAGGGTGCTATG -3'
Posted On2016-06-21