Incidental Mutation 'R5163:Sf3b2'
ID397129
Institutional Source Beutler Lab
Gene Symbol Sf3b2
Ensembl Gene ENSMUSG00000024853
Gene Namesplicing factor 3b, subunit 2
Synonyms145kDa, 2610311M13Rik, 2810441F20Rik, SF3b150, SF3b145, B230398H18Rik, SAP145, SF3b1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5163 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5273923-5295455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5275137 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 769 (V769A)
Ref Sequence ENSEMBL: ENSMUSP00000025774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025774] [ENSMUST00000025786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025774
AA Change: V769A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025774
Gene: ENSMUSG00000024853
AA Change: V769A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
SAP 24 58 1.84e-4 SMART
low complexity region 91 132 N/A INTRINSIC
coiled coil region 140 178 N/A INTRINSIC
low complexity region 201 221 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
low complexity region 408 437 N/A INTRINSIC
Pfam:DUF382 453 579 2.9e-63 PFAM
PSP 584 642 9.41e-33 SMART
low complexity region 693 717 N/A INTRINSIC
low complexity region 745 756 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025786
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Bcor C T X: 12,040,486 R1551Q probably damaging Het
Btbd19 T G 4: 117,121,431 I152L probably damaging Het
Ercc6l2 A G 13: 63,899,031 probably benign Het
Fat4 A G 3: 38,980,797 D2866G probably damaging Het
Fkbp10 C T 11: 100,423,099 A311V probably benign Het
Fnbp1l T C 3: 122,544,663 N511S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gltp A G 5: 114,674,061 I147T probably benign Het
Gpr37 A T 6: 25,669,615 I410N possibly damaging Het
Hivep2 G A 10: 14,139,425 G1779R probably damaging Het
Ifna14 T C 4: 88,571,362 Y146C probably damaging Het
Loxhd1 A G 18: 77,361,736 D662G possibly damaging Het
Lrrc6 T C 15: 66,442,218 D311G probably benign Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Map2k3 T A 11: 60,943,491 I95N probably damaging Het
Mark1 A G 1: 184,905,610 I594T probably damaging Het
Mettl14 T C 3: 123,374,825 I189V possibly damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Odf4 C A 11: 68,922,846 C133F probably damaging Het
Olfr976 T C 9: 39,956,920 N5S probably damaging Het
Opa1 A T 16: 29,597,620 Q106L probably damaging Het
Pax4 T G 6: 28,446,270 S75R probably damaging Het
Ppfibp1 T A 6: 147,022,131 probably null Het
Ptpn20 T C 14: 33,631,111 I269T probably benign Het
Ptprq T C 10: 107,524,331 Q2161R probably damaging Het
Rab22a A G 2: 173,661,487 D31G probably damaging Het
Rap1gds1 A T 3: 138,959,056 M296K probably damaging Het
Rfx1 A G 8: 84,093,211 T692A probably damaging Het
Skint5 A T 4: 113,795,565 F621I unknown Het
Spink5 A C 18: 43,999,857 R513S possibly damaging Het
Srrm2 C T 17: 23,819,550 probably benign Het
Srrt A G 5: 137,296,773 probably null Het
Sun3 T C 11: 9,023,295 Q134R possibly damaging Het
Tpo A G 12: 30,105,980 V174A probably benign Het
Ucp1 A G 8: 83,294,203 R183G possibly damaging Het
Vmn2r66 A G 7: 85,006,809 V333A probably benign Het
Wdr60 C T 12: 116,255,866 R152H possibly damaging Het
Zfp108 G T 7: 24,260,738 K251N probably benign Het
Zfp936 A G 7: 43,190,240 Q377R probably damaging Het
Zkscan2 T C 7: 123,499,867 E34G probably benign Het
Zufsp T A 10: 33,949,443 E14D probably damaging Het
Other mutations in Sf3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sf3b2 APN 19 5279587 missense probably benign 0.00
IGL01737:Sf3b2 APN 19 5279838 splice site probably benign
IGL02205:Sf3b2 APN 19 5283737 missense probably benign 0.01
R0184:Sf3b2 UTSW 19 5283672 missense probably damaging 1.00
R0370:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0371:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0372:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0373:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0375:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R1606:Sf3b2 UTSW 19 5287998 missense probably benign 0.00
R1609:Sf3b2 UTSW 19 5295033 unclassified probably benign
R2566:Sf3b2 UTSW 19 5275090 missense possibly damaging 0.92
R6208:Sf3b2 UTSW 19 5275098 missense possibly damaging 0.82
R6275:Sf3b2 UTSW 19 5283650 missense probably damaging 1.00
R6644:Sf3b2 UTSW 19 5279964 splice site probably null
R6986:Sf3b2 UTSW 19 5279895 missense probably benign
R7007:Sf3b2 UTSW 19 5274517 missense probably benign 0.13
Z1177:Sf3b2 UTSW 19 5274950 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTCCAACTCCAATTCCTCAGGC -3'
(R):5'- CTTATGGGCCTCCTTCAGTG -3'

Sequencing Primer
(F):5'- ACACCTTGCAATTCAGGGG -3'
(R):5'- TTCAGTGGCAGAACCTTCAG -3'
Posted On2016-06-21