Incidental Mutation 'R4723:Myo1d'
ID397164
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission 041959-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4723 (G1)
Quality Score56
Status Validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 80779841 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably benign
Transcript: ENSMUST00000041065
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070997
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125944
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A T 8: 13,735,937 N69I probably damaging Het
Adgrv1 T C 13: 81,433,525 D4800G probably benign Het
Akna T C 4: 63,387,032 D499G probably benign Het
Arid1b A C 17: 5,337,290 I1673L probably benign Het
Bcr T A 10: 75,175,329 M24K probably benign Het
Bsn A G 9: 108,112,655 V1966A probably benign Het
Ccdc39 T C 3: 33,813,078 N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc6 G A 11: 98,908,831 probably null Het
Cmtm1 C T 8: 104,293,675 A371T probably damaging Het
Cmtm7 A C 9: 114,763,391 V46G possibly damaging Het
Cmtr1 A G 17: 29,687,157 probably null Het
Col5a3 T C 9: 20,809,591 H149R unknown Het
Coro7 T G 16: 4,631,994 Q634P probably benign Het
Crym A G 7: 120,201,075 probably null Het
Csmd3 A T 15: 47,669,160 F2546L probably benign Het
Dmap1 T C 4: 117,676,039 T273A probably benign Het
Dnah1 T C 14: 31,272,942 Y2786C probably damaging Het
Echs1 A C 7: 140,110,648 probably benign Het
Edem3 T A 1: 151,804,698 F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 I127V probably benign Het
Fam193a A G 5: 34,420,786 D208G probably benign Het
Farp2 T C 1: 93,580,899 V773A probably benign Het
Gas6 A G 8: 13,466,848 V550A probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2423 A G 13: 13,232,376 noncoding transcript Het
Grin1 T C 2: 25,294,470 S911G probably benign Het
Hkdc1 T C 10: 62,400,354 I470V probably benign Het
Hsdl2 T A 4: 59,593,270 probably benign Het
Iars2 A G 1: 185,315,979 Y519H probably damaging Het
Ikbkb A T 8: 22,669,607 M455K probably benign Het
Keap1 G T 9: 21,231,410 H516Q probably benign Het
Klk1b27 A T 7: 44,056,532 I220F probably damaging Het
Knop1 G A 7: 118,855,864 probably benign Het
Lhcgr T C 17: 88,742,602 T499A probably benign Het
Lrch3 A T 16: 32,988,484 probably null Het
Lrrc2 G A 9: 110,970,160 probably null Het
Lrrk2 T C 15: 91,764,759 L1652P probably damaging Het
Mbl1 T C 14: 41,154,558 V71A possibly damaging Het
Med8 T A 4: 118,411,801 M1K probably null Het
Mfsd2b A G 12: 4,868,992 L88P probably benign Het
Mkrn2 T A 6: 115,611,850 C185S probably damaging Het
Napg T G 18: 62,992,492 probably null Het
Ncor1 A G 11: 62,378,612 M253T probably benign Het
Oas3 T C 5: 120,766,256 T518A unknown Het
Obox3-ps8 A G 17: 36,453,144 noncoding transcript Het
Olfr519 A T 7: 108,893,821 F195L probably benign Het
Olfr656 T C 7: 104,618,489 V270A possibly damaging Het
Olfr71 T C 4: 43,705,785 K261R probably damaging Het
Opn5 A T 17: 42,607,200 M57K probably damaging Het
Pde2a C G 7: 101,494,618 P148R possibly damaging Het
Prss56 C T 1: 87,185,337 L158F possibly damaging Het
Psmg3 G A 5: 139,826,370 probably benign Het
Rnase9 C T 14: 51,039,444 G26R probably damaging Het
Skint4 T C 4: 112,118,236 V131A possibly damaging Het
Slc10a4 T A 5: 73,012,055 V341E probably damaging Het
Slc16a14 T C 1: 84,913,020 Y188C probably damaging Het
Slc7a1 G T 5: 148,335,440 P476T probably damaging Het
Smchd1 A T 17: 71,436,747 C474* probably null Het
Smurf1 A T 5: 144,893,184 D336E probably damaging Het
Sox30 G A 11: 45,984,765 S448N probably benign Het
Spag11a G A 8: 19,159,382 V63I possibly damaging Het
Sprr1b T G 3: 92,437,293 K92T probably damaging Het
Stam2 T C 2: 52,720,950 Y20C probably benign Het
Sult2b1 T A 7: 45,742,065 Y97F probably damaging Het
Tecpr2 C T 12: 110,932,976 P593S probably benign Het
Tek T C 4: 94,799,160 V170A possibly damaging Het
Tiam2 A G 17: 3,450,317 Y891C probably benign Het
Tmem220 A G 11: 67,029,993 T75A possibly damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Txlnb A G 10: 17,799,267 H56R probably benign Het
Vmn2r98 A T 17: 19,066,340 N367Y probably benign Het
Vnn3 A G 10: 23,851,691 I36M possibly damaging Het
Zbtb7a G A 10: 81,144,440 R156H probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80674932 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCTAAAGTGCAGTCCTAG -3'
(R):5'- ATGCCCGTGCCTGTCTTTAG -3'

Sequencing Primer
(F):5'- AGTGCAGTCCTAGACCTCATC -3'
(R):5'- CCTGTCTTTAGGGGGCGC -3'
Posted On2016-06-24