Incidental Mutation 'R4723:Cmtr1'
ID 397167
Institutional Source Beutler Lab
Gene Symbol Cmtr1
Ensembl Gene ENSMUSG00000024019
Gene Name cap methyltransferase 1
Synonyms 1300018I05Rik, Ftsjd2
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R4723 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 29879569-29924953 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to G at 29906131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024816] [ENSMUST00000129864] [ENSMUST00000130871] [ENSMUST00000137079]
AlphaFold Q9DBC3
Predicted Effect probably null
Transcript: ENSMUST00000024816
SMART Domains Protein: ENSMUSP00000024816
Gene: ENSMUSG00000024019

DomainStartEndE-ValueType
G_patch 84 130 1.93e-10 SMART
Pfam:FtsJ 231 448 9.5e-42 PFAM
SCOP:d1ckma2 625 718 4e-3 SMART
WW 752 785 2.05e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128410
Predicted Effect probably benign
Transcript: ENSMUST00000129864
SMART Domains Protein: ENSMUSP00000134356
Gene: ENSMUSG00000024019

DomainStartEndE-ValueType
PDB:4N4A|A 1 68 2e-40 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130052
Predicted Effect probably benign
Transcript: ENSMUST00000130871
SMART Domains Protein: ENSMUSP00000117838
Gene: ENSMUSG00000098374

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
G_patch 524 570 1.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138939
Predicted Effect probably benign
Transcript: ENSMUST00000137079
SMART Domains Protein: ENSMUSP00000115603
Gene: ENSMUSG00000024018

DomainStartEndE-ValueType
Pfam:CCDC-167 9 53 1.1e-16 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Napg T G 18: 63,125,563 (GRCm39) probably null Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Cmtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cmtr1 APN 17 29,893,236 (GRCm39) missense probably damaging 0.99
IGL00980:Cmtr1 APN 17 29,910,258 (GRCm39) missense probably benign 0.00
IGL00987:Cmtr1 APN 17 29,916,143 (GRCm39) missense probably benign 0.01
IGL01413:Cmtr1 APN 17 29,916,956 (GRCm39) missense probably benign 0.00
IGL01481:Cmtr1 APN 17 29,917,631 (GRCm39) missense probably benign 0.02
IGL02281:Cmtr1 APN 17 29,910,255 (GRCm39) missense probably benign 0.00
IGL03079:Cmtr1 APN 17 29,882,267 (GRCm39) missense possibly damaging 0.71
IGL03376:Cmtr1 APN 17 29,910,385 (GRCm39) missense probably benign 0.00
PIT4403001:Cmtr1 UTSW 17 29,917,047 (GRCm39) critical splice donor site probably null
R0256:Cmtr1 UTSW 17 29,916,098 (GRCm39) missense probably damaging 1.00
R0505:Cmtr1 UTSW 17 29,895,259 (GRCm39) missense probably benign 0.17
R1477:Cmtr1 UTSW 17 29,916,131 (GRCm39) missense possibly damaging 0.63
R1623:Cmtr1 UTSW 17 29,906,021 (GRCm39) splice site probably null
R1852:Cmtr1 UTSW 17 29,921,229 (GRCm39) missense probably benign 0.32
R1867:Cmtr1 UTSW 17 29,893,148 (GRCm39) missense probably benign 0.36
R1918:Cmtr1 UTSW 17 29,897,983 (GRCm39) missense possibly damaging 0.63
R2070:Cmtr1 UTSW 17 29,913,757 (GRCm39) critical splice acceptor site probably null
R2071:Cmtr1 UTSW 17 29,913,757 (GRCm39) critical splice acceptor site probably null
R2161:Cmtr1 UTSW 17 29,921,147 (GRCm39) missense probably benign 0.03
R2518:Cmtr1 UTSW 17 29,900,954 (GRCm39) nonsense probably null
R2763:Cmtr1 UTSW 17 29,899,602 (GRCm39) missense possibly damaging 0.89
R4077:Cmtr1 UTSW 17 29,904,949 (GRCm39) missense probably damaging 1.00
R4271:Cmtr1 UTSW 17 29,916,956 (GRCm39) missense probably benign 0.00
R4363:Cmtr1 UTSW 17 29,893,206 (GRCm39) missense probably damaging 1.00
R4736:Cmtr1 UTSW 17 29,919,216 (GRCm39) missense possibly damaging 0.94
R5056:Cmtr1 UTSW 17 29,909,302 (GRCm39) missense possibly damaging 0.64
R5492:Cmtr1 UTSW 17 29,909,316 (GRCm39) missense probably damaging 1.00
R5704:Cmtr1 UTSW 17 29,882,217 (GRCm39) missense possibly damaging 0.95
R5990:Cmtr1 UTSW 17 29,921,135 (GRCm39) missense probably benign
R6050:Cmtr1 UTSW 17 29,901,108 (GRCm39) missense probably damaging 1.00
R6117:Cmtr1 UTSW 17 29,901,139 (GRCm39) missense probably benign 0.43
R6238:Cmtr1 UTSW 17 29,901,122 (GRCm39) missense probably damaging 1.00
R7199:Cmtr1 UTSW 17 29,895,174 (GRCm39) missense probably benign
R7229:Cmtr1 UTSW 17 29,914,398 (GRCm39) critical splice acceptor site probably null
R8337:Cmtr1 UTSW 17 29,893,151 (GRCm39) missense probably benign 0.25
R9538:Cmtr1 UTSW 17 29,882,282 (GRCm39) critical splice donor site probably null
R9607:Cmtr1 UTSW 17 29,893,196 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCAGCATAGTCAGGATGGGTC -3'
(R):5'- CATTTATTGGGTCAGCTCAAGAG -3'

Sequencing Primer
(F):5'- ATGGGTCCTGCTTCTCAGAGC -3'
(R):5'- GCAAAACTAAAGCATTTTTCAAGGGC -3'
Posted On 2016-06-24