Incidental Mutation 'R4588:Olfr869'
ID397173
Institutional Source Beutler Lab
Gene Symbol Olfr869
Ensembl Gene ENSMUSG00000058491
Gene Nameolfactory receptor 869
SynonymsMOR145-6, GA_x6K02T2PVTD-13878275-13879204
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20129009-20138763 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 20138087 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 324 (*324K)
Ref Sequence ENSEMBL: ENSMUSP00000154723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075717] [ENSMUST00000213024]
Predicted Effect probably null
Transcript: ENSMUST00000075717
AA Change: *324K
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: *324K

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212969
Predicted Effect probably null
Transcript: ENSMUST00000213024
AA Change: *324K
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Olfr869
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Olfr869 APN 9 20137235 missense probably benign
IGL01550:Olfr869 APN 9 20137454 missense probably damaging 0.97
IGL02247:Olfr869 APN 9 20137220 missense probably benign 0.01
IGL02448:Olfr869 APN 9 20137641 nonsense probably null
IGL03076:Olfr869 APN 9 20137727 missense probably benign 0.25
R0045:Olfr869 UTSW 9 20137191 missense probably benign 0.25
R0962:Olfr869 UTSW 9 20137538 missense probably damaging 1.00
R4931:Olfr869 UTSW 9 20137562 missense probably benign 0.19
R5030:Olfr869 UTSW 9 20138067 missense probably benign 0.01
R5759:Olfr869 UTSW 9 20137932 missense probably benign 0.12
R5780:Olfr869 UTSW 9 20137497 missense probably damaging 0.98
R6440:Olfr869 UTSW 9 20137194 missense probably damaging 1.00
R6599:Olfr869 UTSW 9 20137943 missense probably damaging 1.00
R6710:Olfr869 UTSW 9 20138082 missense probably benign 0.01
R6953:Olfr869 UTSW 9 20138003 missense probably benign 0.00
R7288:Olfr869 UTSW 9 20137441 nonsense probably null
R7585:Olfr869 UTSW 9 20129011
R7860:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R7943:Olfr869 UTSW 9 20137575 missense probably benign 0.16
R8025:Olfr869 UTSW 9 20137632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGTCTCACCTGTCAGTTG -3'
(R):5'- ATGGATGGTGAACTCGAGTG -3'

Sequencing Primer
(F):5'- GGTCTCACCTGTCAGTTGTTTGC -3'
(R):5'- GTAGTAGAATGAAAGCCACA -3'
Posted On2016-06-27