Mutagenetix > Incidental Mutation

Incidental Mutation 'R4693:Tbx5'

397175

Institutional Source

Beutler Lab

Gene Symbol

Tbx5

Ensembl Gene

ENSMUSG00000018263

Gene Name

T-box 5

Synonyms

MMRRC Submission

041944-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R4693 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119832668-119885219 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119841899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 170 (H170L)

Ref Sequence

ENSEMBL: ENSMUSP00000018407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]

AlphaFold

P70326

Predicted Effect

probably damaging
Transcript: ENSMUST00000018407
AA Change: H170L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: H170L

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	243	9.61e-129	SMART
low complexity region	381	392	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202504
AA Change: H170L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263
AA Change: H170L

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	218	6.3e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202723

SMART Domains

Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	120	3.1e-9	SMART

Meta Mutation Damage Score

0.9533

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	T	C	17: 84,696,697	Y478H	probably damaging	Het
Adar	A	T	3: 89,735,940	H128L	probably damaging	Het
Angptl6	G	T	9: 20,875,302	D349E	probably damaging	Het
Anxa9	T	C	3: 95,297,356	T286A	probably benign	Het
Apobr	A	G	7: 126,586,847	N510S	probably damaging	Het
Atoh7	G	T	10: 63,100,496	R114L	probably benign	Het
Bank1	C	G	3: 136,247,676	R106P	probably damaging	Het
Best1	C	T	19: 9,997,135	G15D	probably damaging	Het
Best2	A	T	8: 85,011,203	F188I	probably damaging	Het
Ccdc88a	T	C	11: 29,482,241	Y344H	probably damaging	Het
Col6a5	A	G	9: 105,937,172	L547P	unknown	Het
Cyp19a1	A	T	9: 54,173,333	S247T	possibly damaging	Het
Cyp26a1	T	C	19: 37,698,477	S126P	probably benign	Het
Dab1	G	T	4: 104,679,553	C180F	probably damaging	Het
Dclk2	T	C	3: 86,815,093	D412G	possibly damaging	Het
Dspp	A	T	5: 104,178,062	S764C	unknown	Het
Dync1li1	C	A	9: 114,706,098	D143E	probably damaging	Het
Esm1	A	T	13: 113,210,060	D73V	probably damaging	Het
Etfdh	A	T	3: 79,605,803	V431E	probably damaging	Het
Fam83c	C	T	2: 155,830,234	R427H	probably damaging	Het
Galnt9	A	G	5: 110,615,509	Y93C	probably damaging	Het
Gm6818	G	A	7: 38,400,702		noncoding transcript	Het
Gm884	T	A	11: 103,619,860	E427D	unknown	Het
Gm8979	T	G	7: 106,082,378		noncoding transcript	Het
Gosr2	A	G	11: 103,683,929	S114P	probably benign	Het
Grip1	G	A	10: 120,000,554	V444I	probably benign	Het
Haus4	G	T	14: 54,549,799	A67E	probably benign	Het
Hectd2	T	A	19: 36,614,338		probably benign	Het
Kndc1	T	C	7: 139,921,779	Y911H	probably benign	Het
Lim2	T	C	7: 43,430,681	Y31H	probably damaging	Het
Lims2	G	A	18: 31,944,499	R101H	probably benign	Het
Lrrc2	T	A	9: 110,970,093	M236K	probably damaging	Het
Lrrk1	T	C	7: 66,262,487	Y1775C	probably damaging	Het
Mdga2	A	G	12: 66,797,633	V197A	possibly damaging	Het
Mfhas1	T	A	8: 35,589,175	L268Q	probably damaging	Het
Mlh1	A	G	9: 111,255,658	I216T	probably damaging	Het
Mrc2	G	A	11: 105,343,702	C1016Y	probably benign	Het
Mvp	C	A	7: 126,998,328	V168F	probably damaging	Het
Mybphl	A	G	3: 108,375,178	T176A	probably benign	Het
Myt1	T	A	2: 181,795,739	L81Q	probably damaging	Het
Ncbp3	T	C	11: 73,075,677	L453S	probably benign	Het
Olfr1157	A	T	2: 87,962,709	F61Y	probably benign	Het
Olfr1219	T	C	2: 89,075,068	T8A	possibly damaging	Het
Olfr1231	T	A	2: 89,303,277	E105V	probably benign	Het
Olfr1456-ps1	C	A	19: 13,078,862		noncoding transcript	Het
Olfr545	T	A	7: 102,494,452	I108F	probably damaging	Het
Pak4	A	T	7: 28,564,249	M354K	probably damaging	Het
Pax3	T	C	1: 78,196,746	T2A	probably benign	Het
Pcdh17	A	G	14: 84,533,520	D1146G	probably damaging	Het
Pcyt1a	T	C	16: 32,470,224		probably benign	Het
Pfkp	C	T	13: 6,600,635	G467D	possibly damaging	Het
Plin4	C	A	17: 56,103,762	G1090C	probably damaging	Het
Pth1r	A	G	9: 110,731,624	V25A	probably damaging	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Ptprf	T	A	4: 118,211,022	E1772D	probably benign	Het
Sall2	T	C	14: 52,314,478	H420R	probably damaging	Het
Sbds	G	A	5: 130,250,975	R63W	probably damaging	Het
Sccpdh	A	G	1: 179,668,410	T19A	possibly damaging	Het
Scn8a	A	T	15: 101,015,691	D988V	probably damaging	Het
Slamf6	C	T	1: 171,934,113	Q34*	probably null	Het
Slc22a6	T	A	19: 8,623,652	I403N	probably damaging	Het
Sox5	T	C	6: 143,835,316	Y574C	probably damaging	Het
Sptbn5	T	A	2: 120,059,416		probably benign	Het
Srcap	T	A	7: 127,538,544	V1022E	probably damaging	Het
Tbx3	G	A	5: 119,677,570	E292K	possibly damaging	Het
Tcf12	A	T	9: 71,868,967		probably benign	Het
Themis	G	A	10: 28,782,651	R558H	probably damaging	Het
Tiam1	T	C	16: 89,843,282	E849G	possibly damaging	Het
Vav3	A	G	3: 109,563,218		probably benign	Het
Vmn2r90	T	A	17: 17,733,694	C707S	possibly damaging	Het
Vmn2r96	T	G	17: 18,583,008	N201K	probably benign	Het
Zfp148	C	T	16: 33,468,135	R207C	probably damaging	Het
Zfp648	G	T	1: 154,204,406	A104S	probably benign	Het

Other mutations in Tbx5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Tbx5	APN	5	119883026	missense	probably benign
IGL01595:Tbx5	APN	5	119840838	missense	probably damaging	1.00
IGL01758:Tbx5	APN	5	119844958	unclassified	probably benign
IGL02239:Tbx5	APN	5	119871280	missense	possibly damaging	0.68
IGL02625:Tbx5	APN	5	119836907	utr 5 prime	probably benign
IGL03326:Tbx5	APN	5	119871298	missense	probably damaging	0.99
R0477:Tbx5	UTSW	5	119883119	missense	possibly damaging	0.89
R0485:Tbx5	UTSW	5	119883458	missense	probably benign	0.00
R1218:Tbx5	UTSW	5	119838720	missense	probably damaging	1.00
R1756:Tbx5	UTSW	5	119845113	splice site	probably null
R2011:Tbx5	UTSW	5	119841906	splice site	probably null
R2125:Tbx5	UTSW	5	119836923	missense	probably benign
R2126:Tbx5	UTSW	5	119836923	missense	probably benign
R2268:Tbx5	UTSW	5	119845109	splice site	probably null
R2302:Tbx5	UTSW	5	119841859	missense	probably damaging	1.00
R4930:Tbx5	UTSW	5	119883025	missense	probably benign	0.44
R5062:Tbx5	UTSW	5	119836922	missense	probably damaging	0.99
R5245:Tbx5	UTSW	5	119883165	missense	possibly damaging	0.95
R6067:Tbx5	UTSW	5	119883146	missense	probably benign
R6079:Tbx5	UTSW	5	119883146	missense	probably benign
R6138:Tbx5	UTSW	5	119883146	missense	probably benign
R6218:Tbx5	UTSW	5	119853598	missense	probably damaging	1.00
R6528:Tbx5	UTSW	5	119883111	missense	probably damaging	0.97
R6700:Tbx5	UTSW	5	119871397	missense	probably benign	0.30
R6993:Tbx5	UTSW	5	119871389	missense	possibly damaging	0.75
R7777:Tbx5	UTSW	5	119883167	missense	probably benign	0.00
R7801:Tbx5	UTSW	5	119836999	missense	probably benign	0.44
R8056:Tbx5	UTSW	5	119853613	missense	probably benign
R8772:Tbx5	UTSW	5	119838725	missense	probably benign	0.02
U15987:Tbx5	UTSW	5	119883146	missense	probably benign
X0028:Tbx5	UTSW	5	119845119	critical splice donor site	probably null
Z1176:Tbx5	UTSW	5	119883315	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCAGCTCTCTTCTGACCAG -3'
(R):5'- CTGACAACTTCAGCCTTGAGG -3'

Sequencing Primer
(F):5'- TCTGACCAGCTACCTCCAGG -3'
(R):5'- GGTGGGTCCCAATTAGCTG -3'

Posted On

2016-06-27