Incidental Mutation 'R4703:Tbxas1'
ID397181
Institutional Source Beutler Lab
Gene Symbol Tbxas1
Ensembl Gene ENSMUSG00000029925
Gene Namethromboxane A synthase 1, platelet
SynonymsTXAS, TXS, CYP5A1, CYP5
MMRRC Submission 041951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4703 (G1)
Quality Score200
Status Validated
Chromosome6
Chromosomal Location38875404-39084585 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 39083857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003017] [ENSMUST00000038398]
Predicted Effect probably null
Transcript: ENSMUST00000003017
SMART Domains Protein: ENSMUSP00000003017
Gene: ENSMUSG00000029925

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
Pfam:p450 44 530 1.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038398
SMART Domains Protein: ENSMUSP00000039704
Gene: ENSMUSG00000038507

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 17 32 N/A INTRINSIC
low complexity region 51 83 N/A INTRINSIC
ZnF_C3H1 99 127 2.79e1 SMART
ZnF_C3H1 186 210 1.36e-2 SMART
ZnF_C3H1 280 306 2.03e1 SMART
Pfam:WWE 385 468 1.3e-16 PFAM
Pfam:PARP 506 689 5.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161781
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to thromboxane A2, a potent vasoconstrictor and inducer of platelet aggregation. The enzyme plays a role in several pathophysiological processes including hemostasis, cardiovascular disease, and stroke. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display increased bleeding time and decreased platelet response to arachidonic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T A 13: 59,689,528 T248S possibly damaging Het
AA986860 T C 1: 130,743,355 V438A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Aox2 T A 1: 58,358,957 F1286I possibly damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgap5 C T 12: 52,517,583 P446S probably damaging Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Armc12 A G 17: 28,532,362 D110G probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
B4galt1 A G 4: 40,823,569 V174A probably benign Het
Bcl11a C A 11: 24,163,725 A356E possibly damaging Het
Bri3bp C T 5: 125,451,766 L110F probably damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Ccdc33 T A 9: 58,033,670 I430F possibly damaging Het
Cgn A G 3: 94,776,095 probably benign Het
Crbn T A 6: 106,782,922 I317F possibly damaging Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Dnah7a C T 1: 53,447,317 probably null Het
Dnajc12 A G 10: 63,386,650 probably null Het
Dntt T A 19: 41,039,803 D179E probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epn1 T A 7: 5,095,148 D319E probably damaging Het
Evpl C G 11: 116,222,505 R1453P probably damaging Het
Focad T A 4: 88,342,321 probably null Het
Foxp2 A T 6: 15,411,248 M542L probably benign Het
Gak T A 5: 108,569,877 Q1299L probably damaging Het
Galnt5 G T 2: 57,998,907 R173I possibly damaging Het
Gli1 G T 10: 127,330,855 P843Q possibly damaging Het
Gm5422 G T 10: 31,249,612 noncoding transcript Het
Gna14 T G 19: 16,598,980 V117G possibly damaging Het
Gpr6 T C 10: 41,071,041 T182A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifih1 A T 2: 62,598,876 L906H probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Ighd A G 12: 113,416,041 probably benign Het
Ighv11-1 A C 12: 113,982,002 I77R possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Il23r A T 6: 67,490,702 I27K probably damaging Het
Inpp5a A C 7: 139,558,923 N261T probably damaging Het
Ints8 T G 4: 11,223,785 Q686P possibly damaging Het
Iqcf4 T C 9: 106,568,320 probably null Het
Irf2bp1 C T 7: 19,005,571 R379C possibly damaging Het
Iws1 C T 18: 32,080,013 P165S probably benign Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcna10 A T 3: 107,194,610 I186F probably benign Het
Limk2 C A 11: 3,347,586 E329* probably null Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Notch1 T G 2: 26,471,158 K1107Q probably benign Het
Nsd1 T A 13: 55,214,063 D281E probably damaging Het
Olfml2a T A 2: 38,951,238 L262Q probably damaging Het
Olfr1294 T A 2: 111,537,768 I174L probably benign Het
Olfr231 A G 1: 174,117,398 I206T possibly damaging Het
Olfr371 A G 8: 85,230,608 T38A possibly damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr557 A T 7: 102,698,270 T11S probably benign Het
Otogl A C 10: 107,821,924 D1048E probably damaging Het
Oxnad1 T C 14: 32,095,470 W96R probably damaging Het
Pcdh15 A T 10: 74,450,163 D743V probably damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcnx C T 12: 81,895,164 T112I probably benign Het
Pctp T C 11: 89,987,273 E145G possibly damaging Het
Pip5k1b T C 19: 24,355,153 K389R probably damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Pnlip T A 19: 58,676,467 D242E probably damaging Het
Ptpn21 T C 12: 98,679,392 T1096A probably benign Het
Rims3 A T 4: 120,883,297 probably benign Het
Rnf219 A G 14: 104,506,208 L145P probably benign Het
Scfd2 T A 5: 74,519,595 Q299L probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc15a5 T C 6: 138,055,645 D237G probably benign Het
Slc16a12 T A 19: 34,674,891 H285L possibly damaging Het
Sox2 C A 3: 34,650,713 R100S probably damaging Het
Sspo G A 6: 48,500,453 C4969Y probably damaging Het
Stxbp2 A G 8: 3,632,521 S37G probably damaging Het
Tcf4 A G 18: 69,657,910 Y307C probably damaging Het
Thsd7b A T 1: 130,049,909 probably benign Het
Tnn G T 1: 160,116,245 D999E possibly damaging Het
Trmt13 C A 3: 116,594,598 W63L probably benign Het
Tsc2 T C 17: 24,604,909 N915S probably benign Het
Tyrp1 T A 4: 80,840,806 probably null Het
Uvrag A T 7: 98,989,587 I315N probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn2r59 T A 7: 42,012,262 I710L probably benign Het
Vmn2r82 A T 10: 79,378,807 H208L probably damaging Het
Wtap T C 17: 12,980,824 T91A probably benign Het
Xirp1 A T 9: 120,017,027 V930E probably damaging Het
Xpo4 T G 14: 57,590,108 H877P probably benign Het
Other mutations in Tbxas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Tbxas1 APN 6 39021181 missense probably damaging 0.97
IGL01319:Tbxas1 APN 6 39017973 missense probably benign 0.09
IGL01633:Tbxas1 APN 6 38982191 missense probably benign 0.00
IGL01712:Tbxas1 APN 6 39081060 missense probably benign 0.00
IGL01860:Tbxas1 APN 6 38948627 missense probably damaging 1.00
IGL01964:Tbxas1 APN 6 39083814 missense probably benign 0.00
IGL02036:Tbxas1 APN 6 39021157 missense probably benign
IGL02335:Tbxas1 APN 6 39023080 missense probably damaging 1.00
IGL02615:Tbxas1 APN 6 39027866 missense probably damaging 1.00
R0245:Tbxas1 UTSW 6 39027768 missense probably benign 0.00
R1677:Tbxas1 UTSW 6 39017888 splice site probably benign
R1975:Tbxas1 UTSW 6 38948641 splice site probably benign
R1977:Tbxas1 UTSW 6 38948641 splice site probably benign
R2308:Tbxas1 UTSW 6 39027661 missense probably benign 0.08
R4394:Tbxas1 UTSW 6 39027779 missense probably benign 0.19
R4702:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4705:Tbxas1 UTSW 6 39083857 critical splice donor site probably null
R4935:Tbxas1 UTSW 6 39023047 missense probably benign 0.02
R5424:Tbxas1 UTSW 6 39027905 missense possibly damaging 0.72
R5704:Tbxas1 UTSW 6 39021133 missense probably benign 0.20
R6358:Tbxas1 UTSW 6 38952112 intron probably benign
R6455:Tbxas1 UTSW 6 38952145 intron probably benign
R6823:Tbxas1 UTSW 6 38919153 start codon destroyed possibly damaging 0.94
R6868:Tbxas1 UTSW 6 39084306 missense probably damaging 1.00
R6888:Tbxas1 UTSW 6 38952074 intron probably benign
R7500:Tbxas1 UTSW 6 38982212 nonsense probably null
R8026:Tbxas1 UTSW 6 39027896 missense probably benign 0.12
Z1177:Tbxas1 UTSW 6 39021104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAGCAGGTATTTCAGGCC -3'
(R):5'- CATGGGATTATTGGCCAGCAC -3'

Sequencing Primer
(F):5'- GGTATTTCAGGCCAACGATAACCTTC -3'
(R):5'- GGCCAGCACTTAATTTGAGC -3'
Posted On2016-06-27