Incidental Mutation 'R4713:Eif3m'
ID 397190
Institutional Source Beutler Lab
Gene Symbol Eif3m
Ensembl Gene ENSMUSG00000027170
Gene Name eukaryotic translation initiation factor 3, subunit M
Synonyms Ga17, Pcid1, Tango7
MMRRC Submission 041601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4713 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 104999656-105017080 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 105006839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028592] [ENSMUST00000111110] [ENSMUST00000148476] [ENSMUST00000148476]
AlphaFold Q99JX4
Predicted Effect possibly damaging
Transcript: ENSMUST00000028592
AA Change: S178R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028592
Gene: ENSMUSG00000027170
AA Change: S178R

DomainStartEndE-ValueType
Blast:HDc 119 209 1e-12 BLAST
PINT 268 357 6.42e-26 SMART
low complexity region 358 372 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111110
AA Change: S46R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106739
Gene: ENSMUSG00000027170
AA Change: S46R

DomainStartEndE-ValueType
Blast:HDc 13 77 7e-8 BLAST
PINT 136 225 6.42e-26 SMART
low complexity region 226 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131266
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000148476
SMART Domains Protein: ENSMUSP00000122339
Gene: ENSMUSG00000027170

DomainStartEndE-ValueType
Blast:PINT 84 126 7e-25 BLAST
low complexity region 127 141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148476
SMART Domains Protein: ENSMUSP00000122339
Gene: ENSMUSG00000027170

DomainStartEndE-ValueType
Blast:PINT 84 126 7e-25 BLAST
low complexity region 127 141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit decreased body weight and altered organ weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tbx10 T C 19: 3,996,921 L108P probably damaging Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Eif3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Eif3m APN 2 105012843 intron probably benign
IGL02661:Eif3m APN 2 105004969 missense probably damaging 0.98
IGL02932:Eif3m APN 2 105014869 missense probably damaging 1.00
R0039:Eif3m UTSW 2 105005872 missense probably damaging 1.00
R0373:Eif3m UTSW 2 105005000 missense probably benign 0.06
R1452:Eif3m UTSW 2 105006777 missense probably damaging 1.00
R1695:Eif3m UTSW 2 105016953 missense probably damaging 0.98
R1934:Eif3m UTSW 2 105001279 missense probably damaging 1.00
R2115:Eif3m UTSW 2 105006796 missense probably damaging 1.00
R2416:Eif3m UTSW 2 105013833 missense probably benign
R4610:Eif3m UTSW 2 105013288 missense probably benign 0.08
R5373:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5374:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5725:Eif3m UTSW 2 105013841 missense probably damaging 0.97
R7996:Eif3m UTSW 2 105001349 missense probably benign 0.22
R8983:Eif3m UTSW 2 104999794 missense possibly damaging 0.70
R9082:Eif3m UTSW 2 105005872 missense probably damaging 1.00
R9227:Eif3m UTSW 2 105001360 missense probably damaging 1.00
R9230:Eif3m UTSW 2 105001360 missense probably damaging 1.00
Z1088:Eif3m UTSW 2 105013256 missense probably damaging 1.00
Z1177:Eif3m UTSW 2 105001274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATTACGTCAGTTGCTGAAC -3'
(R):5'- TTGCTCTATAAAGCCACCCC -3'

Sequencing Primer
(F):5'- GCTGAACTGAAGTCTGTAGCTCATC -3'
(R):5'- AGCCATCTTGGTCACTG -3'
Posted On 2016-06-28