Incidental Mutation 'R4688:Slit2'
ID397197
Institutional Source Beutler Lab
Gene Symbol Slit2
Ensembl Gene ENSMUSG00000031558
Gene Nameslit guidance ligand 2
SynonymsDrad-1, Slil3, E130320P19Rik, E030015M03Rik
MMRRC Submission 041939-MU
Accession Numbers

Ncbi RefSeq: NM_178804.3; MGI: 1315205

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4688 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location47983138-48307733 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 48257003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033967] [ENSMUST00000170109] [ENSMUST00000170109] [ENSMUST00000172493] [ENSMUST00000172493] [ENSMUST00000173107] [ENSMUST00000174313] [ENSMUST00000174313] [ENSMUST00000174421]
Predicted Effect probably benign
Transcript: ENSMUST00000033967
SMART Domains Protein: ENSMUSP00000033967
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170109
SMART Domains Protein: ENSMUSP00000127615
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
LRRCT 851 900 3.9e-13 SMART
EGF 913 947 3.73e-5 SMART
EGF 952 988 4.35e-6 SMART
EGF_CA 990 1026 2.21e-7 SMART
FOLN 993 1015 5.84e1 SMART
EGF 1031 1066 1.07e-5 SMART
EGF_CA 1068 1104 3.97e-9 SMART
FOLN 1116 1138 2.22e0 SMART
EGF 1116 1149 1.62e-5 SMART
LamG 1172 1308 4.82e-39 SMART
EGF 1327 1360 3.68e-4 SMART
EGF 1366 1399 3.88e-3 SMART
FOLN 1407 1429 3.34e0 SMART
EGF 1407 1440 4.46e-3 SMART
CT 1451 1520 4.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170109
SMART Domains Protein: ENSMUSP00000127615
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
LRRCT 851 900 3.9e-13 SMART
EGF 913 947 3.73e-5 SMART
EGF 952 988 4.35e-6 SMART
EGF_CA 990 1026 2.21e-7 SMART
FOLN 993 1015 5.84e1 SMART
EGF 1031 1066 1.07e-5 SMART
EGF_CA 1068 1104 3.97e-9 SMART
FOLN 1116 1138 2.22e0 SMART
EGF 1116 1149 1.62e-5 SMART
LamG 1172 1308 4.82e-39 SMART
EGF 1327 1360 3.68e-4 SMART
EGF 1366 1399 3.88e-3 SMART
FOLN 1407 1429 3.34e0 SMART
EGF 1407 1440 4.46e-3 SMART
CT 1451 1520 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172484
Predicted Effect probably null
Transcript: ENSMUST00000172493
SMART Domains Protein: ENSMUSP00000134655
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
LRR 20 43 3.1e-2 SMART
LRR_TYP 44 67 2.4e-6 SMART
LRR_TYP 68 91 3.2e-6 SMART
LRRCT 103 152 1.8e-15 SMART
EGF 176 210 1.8e-7 SMART
EGF 215 251 2.1e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172493
SMART Domains Protein: ENSMUSP00000134655
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
LRR 20 43 3.1e-2 SMART
LRR_TYP 44 67 2.4e-6 SMART
LRR_TYP 68 91 3.2e-6 SMART
LRRCT 103 152 1.8e-15 SMART
EGF 176 210 1.8e-7 SMART
EGF 215 251 2.1e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172561
Predicted Effect probably null
Transcript: ENSMUST00000173107
SMART Domains Protein: ENSMUSP00000133840
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 505 537 1.45e-6 SMART
LRR_TYP 557 580 1.38e-3 SMART
LRR 605 628 9.96e-1 SMART
LRR_TYP 629 652 2.71e-2 SMART
LRRCT 664 713 3.56e-7 SMART
LRRNT 726 758 3.69e-8 SMART
LRR 776 799 7.36e0 SMART
LRR_TYP 800 823 5.59e-4 SMART
LRR_TYP 824 847 7.9e-4 SMART
LRRCT 859 908 3.9e-13 SMART
EGF 921 955 3.73e-5 SMART
EGF 960 996 4.35e-6 SMART
EGF_CA 998 1034 2.21e-7 SMART
FOLN 1001 1023 5.84e1 SMART
EGF 1039 1074 1.07e-5 SMART
EGF_CA 1076 1112 3.97e-9 SMART
FOLN 1124 1146 2.22e0 SMART
EGF 1124 1157 1.62e-5 SMART
LamG 1180 1316 4.82e-39 SMART
EGF 1335 1368 3.68e-4 SMART
EGF 1374 1407 3.88e-3 SMART
FOLN 1415 1437 3.34e0 SMART
EGF 1415 1448 4.46e-3 SMART
CT 1459 1528 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173671
Predicted Effect probably null
Transcript: ENSMUST00000174313
SMART Domains Protein: ENSMUSP00000133912
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 501 533 1.45e-6 SMART
LRR_TYP 553 576 1.38e-3 SMART
LRR 601 624 9.96e-1 SMART
LRR_TYP 625 648 2.71e-2 SMART
LRRCT 660 709 3.56e-7 SMART
LRRNT 722 754 3.69e-8 SMART
LRR 772 795 7.36e0 SMART
LRR_TYP 796 819 5.59e-4 SMART
LRR_TYP 820 843 7.9e-4 SMART
LRRCT 855 904 3.9e-13 SMART
EGF 917 951 3.73e-5 SMART
EGF 956 992 4.35e-6 SMART
EGF_CA 994 1030 2.21e-7 SMART
FOLN 997 1019 5.84e1 SMART
EGF 1035 1070 1.07e-5 SMART
EGF_CA 1072 1108 3.97e-9 SMART
FOLN 1120 1142 2.22e0 SMART
EGF 1120 1153 1.62e-5 SMART
LamG 1176 1312 4.82e-39 SMART
EGF 1331 1364 3.68e-4 SMART
EGF 1370 1403 3.88e-3 SMART
FOLN 1411 1433 3.34e0 SMART
EGF 1411 1444 4.46e-3 SMART
CT 1455 1524 4.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174313
SMART Domains Protein: ENSMUSP00000133912
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 501 533 1.45e-6 SMART
LRR_TYP 553 576 1.38e-3 SMART
LRR 601 624 9.96e-1 SMART
LRR_TYP 625 648 2.71e-2 SMART
LRRCT 660 709 3.56e-7 SMART
LRRNT 722 754 3.69e-8 SMART
LRR 772 795 7.36e0 SMART
LRR_TYP 796 819 5.59e-4 SMART
LRR_TYP 820 843 7.9e-4 SMART
LRRCT 855 904 3.9e-13 SMART
EGF 917 951 3.73e-5 SMART
EGF 956 992 4.35e-6 SMART
EGF_CA 994 1030 2.21e-7 SMART
FOLN 997 1019 5.84e1 SMART
EGF 1035 1070 1.07e-5 SMART
EGF_CA 1072 1108 3.97e-9 SMART
FOLN 1120 1142 2.22e0 SMART
EGF 1120 1153 1.62e-5 SMART
LamG 1176 1312 4.82e-39 SMART
EGF 1331 1364 3.68e-4 SMART
EGF 1370 1403 3.88e-3 SMART
FOLN 1411 1433 3.34e0 SMART
EGF 1411 1444 4.46e-3 SMART
CT 1455 1524 4.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174421
SMART Domains Protein: ENSMUSP00000134263
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 509 541 1.45e-6 SMART
LRR_TYP 561 584 1.38e-3 SMART
LRR 609 632 9.96e-1 SMART
LRR_TYP 633 656 2.71e-2 SMART
LRRCT 668 717 3.56e-7 SMART
LRRNT 730 762 3.69e-8 SMART
LRR 780 803 7.36e0 SMART
LRR_TYP 804 827 5.59e-4 SMART
LRR_TYP 828 851 7.9e-4 SMART
LRRCT 863 912 3.9e-13 SMART
EGF 925 959 3.73e-5 SMART
EGF 964 1000 4.35e-6 SMART
EGF_CA 1002 1047 4.74e-7 SMART
FOLN 1005 1027 5.84e1 SMART
EGF 1052 1087 1.07e-5 SMART
EGF_CA 1089 1125 3.97e-9 SMART
FOLN 1137 1159 2.22e0 SMART
EGF 1137 1170 1.62e-5 SMART
LamG 1193 1329 4.82e-39 SMART
EGF 1348 1381 3.68e-4 SMART
EGF 1387 1420 3.88e-3 SMART
FOLN 1428 1450 3.34e0 SMART
EGF 1428 1461 4.46e-3 SMART
CT 1472 1541 4.23e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype Strain: 2179460
FUNCTION: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and hydroureter. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,593,449 S530P probably benign Het
1700003E16Rik A G 6: 83,162,698 N535S probably damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
9930021J03Rik A G 19: 29,717,101 I1664T probably benign Het
Abcc12 T C 8: 86,548,694 S452G possibly damaging Het
Acacb C A 5: 114,204,763 Q897K probably benign Het
Acot3 C A 12: 84,053,917 R145S probably damaging Het
AI314180 A G 4: 58,840,757 V667A probably damaging Het
Ankrd54 A T 15: 79,054,582 Y247N probably damaging Het
Arl11 G A 14: 61,311,097 V119I probably benign Het
Atxn7 T A 14: 14,089,288 M268K probably benign Het
Bms1 G A 6: 118,392,706 R934C probably damaging Het
Ccdc129 G A 6: 55,967,147 probably null Het
Chrnb3 T C 8: 27,394,119 S295P probably damaging Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Cnr1 A T 4: 33,944,571 I320F probably benign Het
Cntn4 C T 6: 106,437,949 P147L probably damaging Het
Col24a1 G A 3: 145,314,383 V172I probably benign Het
Col9a3 A G 2: 180,607,631 D262G probably damaging Het
Csrnp2 A G 15: 100,482,360 V350A probably damaging Het
D630045J12Rik A G 6: 38,196,657 V192A possibly damaging Het
Deptor A G 15: 55,208,781 M219V probably benign Het
Dmrtb1 A T 4: 107,684,050 L38Q probably damaging Het
Dvl2 G A 11: 70,007,518 R367Q possibly damaging Het
Dync1h1 T G 12: 110,655,528 I3435S probably damaging Het
Eif2b3 A G 4: 117,058,849 N218D probably benign Het
Epha2 A G 4: 141,318,981 D497G probably benign Het
Epha7 G T 4: 28,821,367 L177F probably damaging Het
Fam214b A G 4: 43,034,663 F352S probably damaging Het
Fam98c C T 7: 29,155,241 E147K probably damaging Het
Fbxo17 A G 7: 28,732,554 T19A probably benign Het
Fbxo47 A G 11: 97,856,223 F339S probably damaging Het
Frmd4a G T 2: 4,537,311 V234L possibly damaging Het
Gal3st2 A G 1: 93,872,523 D32G probably damaging Het
Gpr135 T C 12: 72,070,946 T16A probably benign Het
Gpr160 A T 3: 30,896,686 R302S probably benign Het
Hrh2 C A 13: 54,214,801 N265K probably benign Het
Htatip2 C A 7: 49,773,423 A242E probably damaging Het
Igfbp7 T C 5: 77,407,635 Y127C probably damaging Het
Igkv16-104 A G 6: 68,425,894 Q57R possibly damaging Het
Ino80c A G 18: 24,108,846 S161P probably damaging Het
Kcnc1 A G 7: 46,397,835 D53G probably benign Het
Lce1h G T 3: 92,763,567 R93S unknown Het
Lce1k T C 3: 92,806,644 S78G unknown Het
Lhcgr T A 17: 88,765,152 I156F probably damaging Het
Lpl T C 8: 68,899,425 Y343H probably damaging Het
Lrp6 G T 6: 134,479,743 R853S probably damaging Het
Lrrc7 A G 3: 158,148,605 V1322A probably damaging Het
Lrrc74a C T 12: 86,737,698 Q67* probably null Het
Megf6 A T 4: 154,253,814 D447V probably damaging Het
Mep1a T C 17: 43,482,248 D355G possibly damaging Het
Ncoa1 T C 12: 4,315,781 D95G probably benign Het
Npepl1 A T 2: 174,114,442 I139F possibly damaging Het
Nrcam T C 12: 44,547,237 S262P probably benign Het
Nrp1 A G 8: 128,502,566 N842D probably benign Het
Olfml3 A G 3: 103,732,181 probably benign Het
Olfr1375 A G 11: 51,048,988 R294G probably damaging Het
Olfr1505 A T 19: 13,919,241 T74S probably benign Het
Olfr32 T A 2: 90,138,999 N47Y possibly damaging Het
Olfr421-ps1 T C 1: 174,151,596 Y27H possibly damaging Het
Olfr711 T A 7: 106,971,861 Y161F probably benign Het
Olfr773 G A 10: 129,186,645 P259S probably damaging Het
Olfr918 A G 9: 38,673,363 L27P probably damaging Het
Pde2a A G 7: 101,502,834 N316S probably benign Het
Pde4dip T A 3: 97,843,677 R74* probably null Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Piezo1 A T 8: 122,488,539 W1444R probably damaging Het
Pla2g4e T C 2: 120,167,933 K843R possibly damaging Het
Plxna2 C T 1: 194,644,445 P229L probably damaging Het
Prelid3b G T 2: 174,466,799 T131K probably benign Het
Pros1 T C 16: 62,889,007 probably null Het
Prrc2c G T 1: 162,697,687 P450Q unknown Het
Ptbp1 G T 10: 79,856,508 V5F possibly damaging Het
Ptk2 T A 15: 73,206,225 L997F probably damaging Het
Rims1 G T 1: 22,479,447 S525* probably null Het
Sh2b3 T A 5: 121,818,634 D318V probably benign Het
Slc16a13 A T 11: 70,220,275 I88N probably damaging Het
Snx10 A G 6: 51,579,938 N67S probably damaging Het
Stil A G 4: 115,041,308 Y1045C probably damaging Het
Stra6 A G 9: 58,135,076 probably null Het
Sympk A G 7: 19,054,410 S1254G probably benign Het
Syt15 G T 14: 34,228,054 G377V probably damaging Het
Taar4 A T 10: 23,960,833 I114F probably damaging Het
Tcaf3 G A 6: 42,593,366 probably null Het
Tgm7 A T 2: 121,094,021 N558K probably benign Het
Tln2 T G 9: 67,397,653 M1L probably benign Het
Trim50 C T 5: 135,367,140 T314I probably damaging Het
Trp53rka A T 2: 165,491,392 Y192* probably null Het
Ube3b T C 5: 114,393,078 V211A probably benign Het
Ush2a A G 1: 188,399,941 S787G probably benign Het
Vmn1r189 T C 13: 22,102,119 M183V probably damaging Het
Vps13d G T 4: 145,178,212 Q115K probably benign Het
Zfp358 A G 8: 3,495,493 D25G probably damaging Het
Zfp521 T G 18: 13,844,590 K922T probably damaging Het
Zfp521 T A 18: 13,844,591 K922* probably null Het
Zfp68 T A 5: 138,616,481 K4* probably null Het
Other mutations in Slit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Slit2 APN 5 48304032 missense possibly damaging 0.86
IGL00809:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00811:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00813:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00815:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00816:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00817:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00819:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00820:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00822:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL01077:Slit2 APN 5 48217443 splice site probably null
IGL01375:Slit2 APN 5 48281714 splice site probably benign
IGL01481:Slit2 APN 5 48302931 missense probably benign 0.05
IGL01934:Slit2 APN 5 48238405 missense possibly damaging 0.93
IGL01992:Slit2 APN 5 48238417 missense probably benign 0.01
IGL02315:Slit2 APN 5 47987871 missense probably damaging 0.98
IGL02328:Slit2 APN 5 48230304 missense probably damaging 1.00
IGL02366:Slit2 APN 5 48304068 missense possibly damaging 0.53
IGL02526:Slit2 APN 5 48304223 nonsense probably null
IGL02852:Slit2 APN 5 48244672 missense probably damaging 1.00
IGL02887:Slit2 APN 5 48217474 missense probably benign 0.44
IGL03123:Slit2 APN 5 48211339 missense probably damaging 1.00
IGL03182:Slit2 APN 5 48220053 missense possibly damaging 0.77
P0025:Slit2 UTSW 5 48304035 missense probably damaging 0.96
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0267:Slit2 UTSW 5 48182331 splice site probably benign
R0552:Slit2 UTSW 5 48238379 missense probably damaging 1.00
R0610:Slit2 UTSW 5 48275674 missense possibly damaging 0.77
R0883:Slit2 UTSW 5 48245573 splice site probably benign
R1390:Slit2 UTSW 5 48217490 missense probably benign 0.06
R1442:Slit2 UTSW 5 48238383 missense probably damaging 0.96
R1453:Slit2 UTSW 5 48257051 missense possibly damaging 0.88
R1508:Slit2 UTSW 5 48192249 missense probably damaging 0.98
R1639:Slit2 UTSW 5 48259654 missense probably damaging 1.00
R1705:Slit2 UTSW 5 48189472 missense probably damaging 0.99
R1828:Slit2 UTSW 5 48304030 missense probably damaging 1.00
R1897:Slit2 UTSW 5 48238423 missense probably damaging 1.00
R1908:Slit2 UTSW 5 48281988 missense probably damaging 1.00
R1919:Slit2 UTSW 5 48191016 unclassified probably benign
R1982:Slit2 UTSW 5 48249836 missense probably damaging 1.00
R2013:Slit2 UTSW 5 48302490 missense probably damaging 1.00
R2136:Slit2 UTSW 5 48304225 missense probably benign 0.03
R2655:Slit2 UTSW 5 48189575 missense possibly damaging 0.88
R3402:Slit2 UTSW 5 48283421 missense probably damaging 0.98
R3724:Slit2 UTSW 5 48256883 critical splice donor site probably null
R4176:Slit2 UTSW 5 48237244 splice site probably null
R4306:Slit2 UTSW 5 48302783 missense possibly damaging 0.83
R4397:Slit2 UTSW 5 48220081 critical splice donor site probably null
R4525:Slit2 UTSW 5 48249873 missense probably damaging 1.00
R5026:Slit2 UTSW 5 48256805 missense probably damaging 0.99
R5138:Slit2 UTSW 5 48281967 missense probably damaging 1.00
R5465:Slit2 UTSW 5 48249912 missense probably damaging 1.00
R5471:Slit2 UTSW 5 48189555 missense probably damaging 1.00
R5699:Slit2 UTSW 5 48220991 critical splice donor site probably null
R5735:Slit2 UTSW 5 48259616 missense probably damaging 1.00
R5834:Slit2 UTSW 5 48259647 missense probably damaging 1.00
R5967:Slit2 UTSW 5 47985164 missense probably damaging 0.99
R6150:Slit2 UTSW 5 48304174 missense probably damaging 1.00
R6219:Slit2 UTSW 5 48302428 missense possibly damaging 0.53
R6344:Slit2 UTSW 5 48219681 missense probably benign 0.07
R6408:Slit2 UTSW 5 47984986 unclassified probably benign
R6479:Slit2 UTSW 5 48231989 missense probably damaging 1.00
R6526:Slit2 UTSW 5 48304167 missense probably damaging 0.99
R6959:Slit2 UTSW 5 48238385 missense possibly damaging 0.83
R7139:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7201:Slit2 UTSW 5 48237285 missense probably null 0.85
R7472:Slit2 UTSW 5 48256838 missense probably damaging 0.97
R7491:Slit2 UTSW 5 48219994 missense probably benign 0.18
R7566:Slit2 UTSW 5 48249897 missense probably damaging 0.99
R7622:Slit2 UTSW 5 47985205 missense probably damaging 0.98
R7831:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7870:Slit2 UTSW 5 48302307 missense probably damaging 0.99
R7899:Slit2 UTSW 5 48247185 missense possibly damaging 0.89
R7969:Slit2 UTSW 5 48304036 missense possibly damaging 0.47
R7984:Slit2 UTSW 5 48176123 intron probably benign
R8021:Slit2 UTSW 5 48302492 nonsense probably null
R8253:Slit2 UTSW 5 48275671 missense probably benign 0.00
R8321:Slit2 UTSW 5 48230267 missense probably damaging 1.00
R8426:Slit2 UTSW 5 48224763 missense probably benign 0.00
R8513:Slit2 UTSW 5 48224708 nonsense probably null
R8756:Slit2 UTSW 5 48302487 nonsense probably null
R8796:Slit2 UTSW 5 48302848 missense probably benign 0.01
R8799:Slit2 UTSW 5 48304182 missense possibly damaging 0.73
R8947:Slit2 UTSW 5 48249798 missense probably damaging 1.00
Z1088:Slit2 UTSW 5 48302353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACCTGTAACAATGACC -3'
(R):5'- GTGCTGTCTCTTTCATGGATCAATC -3'

Sequencing Primer
(F):5'- CCTGTAACAATGACCCCGTTG -3'
(R):5'- TGTCTCTTTCATGGATCAATCAATAC -3'
Posted On2016-06-28