Incidental Mutation 'R4723:Napg'
ID 397225
Institutional Source Beutler Lab
Gene Symbol Napg
Ensembl Gene ENSMUSG00000024581
Gene Name N-ethylmaleimide sensitive fusion protein attachment protein gamma
Synonyms 2400003O04Rik, SNARE
MMRRC Submission 041959-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R4723 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 63110910-63132521 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 63125563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025474] [ENSMUST00000150267]
AlphaFold Q9CWZ7
Predicted Effect probably benign
Transcript: ENSMUST00000025474
SMART Domains Protein: ENSMUSP00000025474
Gene: ENSMUSG00000024581

DomainStartEndE-ValueType
Pfam:SNAP 7 261 1e-30 PFAM
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124837
Predicted Effect probably null
Transcript: ENSMUST00000150267
SMART Domains Protein: ENSMUSP00000122681
Gene: ENSMUSG00000024581

DomainStartEndE-ValueType
Pfam:SNAP 7 195 6.7e-23 PFAM
low complexity region 204 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155440
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes soluble NSF attachment protein gamma. The soluble NSF attachment proteins (SNAPs) enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. The product of this gene mediates platelet exocytosis and controls the membrane fusion events of this process.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,581,644 (GRCm39) D4800G probably benign Het
Akna T C 4: 63,305,269 (GRCm39) D499G probably benign Het
Arid1b A C 17: 5,387,565 (GRCm39) I1673L probably benign Het
Bcr T A 10: 75,011,161 (GRCm39) M24K probably benign Het
Bsn A G 9: 107,989,854 (GRCm39) V1966A probably benign Het
Ccdc39 T C 3: 33,867,227 (GRCm39) N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdc6 G A 11: 98,799,657 (GRCm39) probably null Het
Cfap97d2 A T 8: 13,785,937 (GRCm39) N69I probably damaging Het
Cmtm1 C T 8: 105,020,307 (GRCm39) A371T probably damaging Het
Cmtm7 A C 9: 114,592,459 (GRCm39) V46G possibly damaging Het
Cmtr1 A G 17: 29,906,131 (GRCm39) probably null Het
Col5a3 T C 9: 20,720,887 (GRCm39) H149R unknown Het
Coro7 T G 16: 4,449,858 (GRCm39) Q634P probably benign Het
Crym A G 7: 119,800,298 (GRCm39) probably null Het
Csmd3 A T 15: 47,532,556 (GRCm39) F2546L probably benign Het
Dmap1 T C 4: 117,533,236 (GRCm39) T273A probably benign Het
Dnah1 T C 14: 30,994,899 (GRCm39) Y2786C probably damaging Het
Echs1 A C 7: 139,690,561 (GRCm39) probably benign Het
Edem3 T A 1: 151,680,449 (GRCm39) F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 (GRCm39) I127V probably benign Het
Fam193a A G 5: 34,578,130 (GRCm39) D208G probably benign Het
Farp2 T C 1: 93,508,621 (GRCm39) V773A probably benign Het
Gas6 A G 8: 13,516,848 (GRCm39) V550A probably damaging Het
Gkn3 C T 6: 87,360,507 (GRCm39) A163T probably damaging Het
Gm2423 A G 13: 13,406,961 (GRCm39) noncoding transcript Het
Grin1 T C 2: 25,184,482 (GRCm39) S911G probably benign Het
Hkdc1 T C 10: 62,236,133 (GRCm39) I470V probably benign Het
Hsdl2 T A 4: 59,593,270 (GRCm39) probably benign Het
Iars2 A G 1: 185,048,176 (GRCm39) Y519H probably damaging Het
Ikbkb A T 8: 23,159,623 (GRCm39) M455K probably benign Het
Keap1 G T 9: 21,142,706 (GRCm39) H516Q probably benign Het
Klk1b27 A T 7: 43,705,956 (GRCm39) I220F probably damaging Het
Knop1 G A 7: 118,455,087 (GRCm39) probably benign Het
Lhcgr T C 17: 89,050,030 (GRCm39) T499A probably benign Het
Lrch3 A T 16: 32,808,854 (GRCm39) probably null Het
Lrrc2 G A 9: 110,799,228 (GRCm39) probably null Het
Lrrk2 T C 15: 91,648,962 (GRCm39) L1652P probably damaging Het
Mbl1 T C 14: 40,876,515 (GRCm39) V71A possibly damaging Het
Med8 T A 4: 118,268,998 (GRCm39) M1K probably null Het
Mfsd2b A G 12: 4,918,992 (GRCm39) L88P probably benign Het
Mkrn2 T A 6: 115,588,811 (GRCm39) C185S probably damaging Het
Myo1d A G 11: 80,670,667 (GRCm39) probably benign Het
Ncor1 A G 11: 62,269,438 (GRCm39) M253T probably benign Het
Oas3 T C 5: 120,904,321 (GRCm39) T518A unknown Het
Obox3-ps8 A G 17: 36,764,036 (GRCm39) noncoding transcript Het
Opn5 A T 17: 42,918,091 (GRCm39) M57K probably damaging Het
Or10a3n A T 7: 108,493,028 (GRCm39) F195L probably benign Het
Or13j1 T C 4: 43,705,785 (GRCm39) K261R probably damaging Het
Or52p1 T C 7: 104,267,696 (GRCm39) V270A possibly damaging Het
Pde2a C G 7: 101,143,825 (GRCm39) P148R possibly damaging Het
Prss56 C T 1: 87,113,059 (GRCm39) L158F possibly damaging Het
Psmg3 G A 5: 139,812,125 (GRCm39) probably benign Het
Rnase9 C T 14: 51,276,901 (GRCm39) G26R probably damaging Het
Skint4 T C 4: 111,975,433 (GRCm39) V131A possibly damaging Het
Slc10a4 T A 5: 73,169,398 (GRCm39) V341E probably damaging Het
Slc16a14 T C 1: 84,890,741 (GRCm39) Y188C probably damaging Het
Slc7a1 G T 5: 148,272,250 (GRCm39) P476T probably damaging Het
Smchd1 A T 17: 71,743,742 (GRCm39) C474* probably null Het
Smurf1 A T 5: 144,829,994 (GRCm39) D336E probably damaging Het
Sox30 G A 11: 45,875,592 (GRCm39) S448N probably benign Het
Spag11a G A 8: 19,209,398 (GRCm39) V63I possibly damaging Het
Sprr1b T G 3: 92,344,600 (GRCm39) K92T probably damaging Het
Stam2 T C 2: 52,610,962 (GRCm39) Y20C probably benign Het
Sult2b1 T A 7: 45,391,489 (GRCm39) Y97F probably damaging Het
Tecpr2 C T 12: 110,899,410 (GRCm39) P593S probably benign Het
Tek T C 4: 94,687,397 (GRCm39) V170A possibly damaging Het
Tiam2 A G 17: 3,500,592 (GRCm39) Y891C probably benign Het
Tmem220 A G 11: 66,920,819 (GRCm39) T75A possibly damaging Het
Traf3 T G 12: 111,228,470 (GRCm39) D560E probably damaging Het
Txlnb A G 10: 17,675,015 (GRCm39) H56R probably benign Het
Vmn2r98 A T 17: 19,286,602 (GRCm39) N367Y probably benign Het
Vnn3 A G 10: 23,727,589 (GRCm39) I36M possibly damaging Het
Zbtb7a G A 10: 80,980,274 (GRCm39) R156H probably damaging Het
Other mutations in Napg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Napg APN 18 63,119,516 (GRCm39) missense probably benign 0.21
IGL02728:Napg APN 18 63,127,375 (GRCm39) splice site probably benign
IGL02742:Napg APN 18 63,119,319 (GRCm39) missense probably damaging 0.99
R0276:Napg UTSW 18 63,120,034 (GRCm39) missense probably damaging 1.00
R0277:Napg UTSW 18 63,120,034 (GRCm39) missense probably damaging 1.00
R0323:Napg UTSW 18 63,120,034 (GRCm39) missense probably damaging 1.00
R0325:Napg UTSW 18 63,120,034 (GRCm39) missense probably damaging 1.00
R0751:Napg UTSW 18 63,127,409 (GRCm39) missense probably benign 0.04
R0988:Napg UTSW 18 63,116,431 (GRCm39) splice site probably benign
R1184:Napg UTSW 18 63,127,409 (GRCm39) missense probably benign 0.04
R1387:Napg UTSW 18 63,119,283 (GRCm39) missense possibly damaging 0.50
R1678:Napg UTSW 18 63,117,143 (GRCm39) critical splice donor site probably null
R1779:Napg UTSW 18 63,115,762 (GRCm39) missense probably benign 0.33
R5848:Napg UTSW 18 63,127,440 (GRCm39) missense possibly damaging 0.49
R5874:Napg UTSW 18 63,111,091 (GRCm39) nonsense probably null
R5973:Napg UTSW 18 63,128,054 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATTCTATGGGTCTTCATCTGC -3'
(R):5'- AGTGTGATTTAACTGCACTCAACCC -3'

Sequencing Primer
(F):5'- GTTTCTGACCATGACAGACCTAG -3'
(R):5'- ACCCTCCCAGGTTCACG -3'
Posted On 2016-06-28