Incidental Mutation 'R4692:Car10'
ID397231
Institutional Source Beutler Lab
Gene Symbol Car10
Ensembl Gene ENSMUSG00000056158
Gene Namecarbonic anhydrase 10
SynonymsCA-RP X, 2700029L05Rik
MMRRC Submission 041943-MU
Accession Numbers

Genbank: NM_028296; MGI: 1919855

Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93098028-93601749 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 93185158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042943] [ENSMUST00000107858] [ENSMUST00000107859] [ENSMUST00000107861] [ENSMUST00000107863]
Predicted Effect probably null
Transcript: ENSMUST00000042943
SMART Domains Protein: ENSMUSP00000035585
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092780
SMART Domains Protein: ENSMUSP00000090455
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107858
SMART Domains Protein: ENSMUSP00000103490
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 277 2.21e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107859
SMART Domains Protein: ENSMUSP00000103491
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:Carb_anhydrase 33 98 8e-40 BLAST
SCOP:d2znc__ 33 99 1e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107861
SMART Domains Protein: ENSMUSP00000103493
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 169 2.14e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107863
SMART Domains Protein: ENSMUSP00000103495
Gene: ENSMUSG00000056158

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 S232P probably damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Car10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Car10 APN 11 93304657 splice site probably benign
IGL01077:Car10 APN 11 93597143 missense possibly damaging 0.54
IGL01099:Car10 APN 11 93578690 missense possibly damaging 0.91
IGL02810:Car10 APN 11 93578696 missense probably damaging 1.00
IGL03037:Car10 APN 11 93100218 utr 5 prime probably benign
IGL03061:Car10 APN 11 93490525 missense probably damaging 0.98
IGL03105:Car10 APN 11 93100275 missense probably benign 0.07
IGL03347:Car10 APN 11 93100296 splice site probably benign
IGL02837:Car10 UTSW 11 93597251 missense probably damaging 0.96
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0387:Car10 UTSW 11 93583021 critical splice donor site probably null
R0511:Car10 UTSW 11 93490582 missense probably damaging 1.00
R1372:Car10 UTSW 11 93578699 missense probably benign 0.02
R4799:Car10 UTSW 11 93578666 missense possibly damaging 0.81
R5947:Car10 UTSW 11 93490613 missense probably damaging 1.00
R6010:Car10 UTSW 11 93599323 missense possibly damaging 0.52
R6013:Car10 UTSW 11 93185279 intron probably benign
R7268:Car10 UTSW 11 93599251 missense probably benign 0.26
R7995:Car10 UTSW 11 93597122 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGCCTTGAAGTAGGAAAG -3'
(R):5'- AGACCATGTAGCAAATGTGACATTG -3'

Sequencing Primer
(F):5'- AAAGGGCGATGTCTTGGATATTTAC -3'
(R):5'- AACATTAGTGTTCATCCAAATTCTGG -3'
Posted On2016-06-28