Incidental Mutation 'R4706:Rtel1'
ID397232
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission 041954-MU
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4706 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 181323746 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000098971] [ENSMUST00000108814] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000108815] [ENSMUST00000148252] [ENSMUST00000153112]
Predicted Effect probably null
Transcript: ENSMUST00000048608
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably null
Transcript: ENSMUST00000048608
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably null
Transcript: ENSMUST00000054622
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054622
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098971
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098971
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108814
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108814
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108815
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108815
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146273
Predicted Effect probably benign
Transcript: ENSMUST00000148252
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153112
SMART Domains Protein: ENSMUSP00000118810
Gene: ENSMUSG00000038685

DomainStartEndE-ValueType
Pfam:ResIII 14 101 1.8e-7 PFAM
Pfam:DEAD_2 111 161 3.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sec24d T A 3: 123,355,778 N811K possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 intron probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6835:Rtel1 UTSW 2 181355953 missense probably benign 0.04
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
R7523:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7587:Rtel1 UTSW 2 181322315 missense probably damaging 1.00
R7681:Rtel1 UTSW 2 181322394 missense probably damaging 0.99
R7871:Rtel1 UTSW 2 181321029 missense probably damaging 1.00
R7912:Rtel1 UTSW 2 181356076 missense possibly damaging 0.56
R8007:Rtel1 UTSW 2 181334974 missense probably damaging 1.00
R8062:Rtel1 UTSW 2 181340567 missense probably benign 0.17
R8088:Rtel1 UTSW 2 181322345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTGGACACAGTGCTCC -3'
(R):5'- CGCTCTTCTCCATGTAATACCAAG -3'

Sequencing Primer
(F):5'- CTGGGCCAGAGTTTAGAGAACAC -3'
(R):5'- TCTCCATGTAATACCAAGGAGGAAAC -3'
Posted On2016-06-28