Incidental Mutation 'R4488:Vcp'
ID397250
Institutional Source Beutler Lab
Gene Symbol Vcp
Ensembl Gene ENSMUSG00000028452
Gene Namevalosin containing protein
SynonymsAAA ATPase p97, p97/VCP, p97, CDC48
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42979963-43000507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42993826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 102 (I102N)
Ref Sequence ENSEMBL: ENSMUSP00000030164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164]
PDB Structure
STRUCTURE OF THE N-TERMINAL DOMAIN AND THE D1 AAA DOMAIN OF MEMBRANE FUSION ATPASE P97 [X-RAY DIFFRACTION]
The crystal structure of murine p97/VCP at 3.6A [X-RAY DIFFRACTION]
Crystal structure of AAA ATPase p97/VCP ND1 in complex with p47 C [X-RAY DIFFRACTION]
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Structure of D2 subdomain of P97/VCP in complex with ADP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/ADP.alfx [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/AMP-PNP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030164
AA Change: I102N

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452
AA Change: I102N

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154423
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. Mice homozygous for a knock-in allele exhibit progressive muscle weakness, myopathy, decreased bone density, increased osteoclast genesis, and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Vcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Vcp APN 4 42996040 missense possibly damaging 0.69
IGL02251:Vcp APN 4 42988728 missense possibly damaging 0.49
H8562:Vcp UTSW 4 42982596 missense probably damaging 1.00
R0627:Vcp UTSW 4 42983011 missense possibly damaging 0.83
R0639:Vcp UTSW 4 42982565 missense probably benign 0.00
R0711:Vcp UTSW 4 42986201 missense probably benign 0.22
R0766:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1312:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1702:Vcp UTSW 4 42990840 missense probably damaging 1.00
R2071:Vcp UTSW 4 42995894 critical splice donor site probably null
R2192:Vcp UTSW 4 42982547 missense probably benign
R2262:Vcp UTSW 4 42980828 missense probably benign 0.04
R2265:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2268:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2269:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2443:Vcp UTSW 4 42983385 missense probably damaging 1.00
R2937:Vcp UTSW 4 42980846 missense probably damaging 1.00
R2973:Vcp UTSW 4 42996315 missense probably damaging 1.00
R4004:Vcp UTSW 4 42983028 missense probably damaging 1.00
R4546:Vcp UTSW 4 42988813 intron probably benign
R4578:Vcp UTSW 4 42984565 missense probably benign 0.41
R4817:Vcp UTSW 4 42983486 missense probably damaging 1.00
R4869:Vcp UTSW 4 42993691 missense probably benign 0.00
R5014:Vcp UTSW 4 42980828 missense probably benign 0.04
R6128:Vcp UTSW 4 42980941 missense probably benign 0.00
R6594:Vcp UTSW 4 42993826 missense probably damaging 0.96
R7105:Vcp UTSW 4 42985991 missense probably damaging 1.00
R7470:Vcp UTSW 4 42982891 missense probably damaging 1.00
R8006:Vcp UTSW 4 42985993 missense probably benign 0.04
R8234:Vcp UTSW 4 42985242 missense probably damaging 1.00
R8313:Vcp UTSW 4 42988728 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACAACTGAATATGTGTGCAGGC -3'
(R):5'- CCTCATCGTGAATGTGACCTG -3'

Sequencing Primer
(F):5'- CTGAATATGTGTGCAGGCTATATC -3'
(R):5'- CTCATCGTGAATGTGACCTGTCTTAG -3'
Posted On2016-06-29