Incidental Mutation 'R4504:Fndc8'
ID397253
Institutional Source Beutler Lab
Gene Symbol Fndc8
Ensembl Gene ENSMUSG00000018844
Gene Namefibronectin type III domain containing 8
Synonyms
MMRRC Submission 041755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R4504 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82892124-82900801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82892400 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 69 (M69K)
Ref Sequence ENSEMBL: ENSMUSP00000018988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018985] [ENSMUST00000018988] [ENSMUST00000021033] [ENSMUST00000092844] [ENSMUST00000100718] [ENSMUST00000135963] [ENSMUST00000146053]
Predicted Effect probably benign
Transcript: ENSMUST00000018985
SMART Domains Protein: ENSMUSP00000018985
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 2e-27 PDB
AAA 99 274 1.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018988
AA Change: M69K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844
AA Change: M69K

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021033
SMART Domains Protein: ENSMUSP00000021033
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 249 3e-15 PFAM
Pfam:AAA_25 69 200 2e-12 PFAM
Pfam:KaiC 82 148 1.4e-10 PFAM
Pfam:AAA_19 93 168 6.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092844
SMART Domains Protein: ENSMUSP00000090520
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 66 130 2.4e-7 PFAM
Pfam:KaiC 82 129 8e-8 PFAM
Pfam:Rad51 115 274 8.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100718
SMART Domains Protein: ENSMUSP00000098284
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 5e-30 PDB
SCOP:d1b22a_ 10 48 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135963
SMART Domains Protein: ENSMUSP00000122477
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 219 7e-18 PFAM
Pfam:AAA_25 69 226 2.6e-15 PFAM
Pfam:KaiC 82 216 5.7e-12 PFAM
Pfam:AAA_19 93 168 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146053
SMART Domains Protein: ENSMUSP00000117401
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 48 1e-13 PDB
SCOP:d1b22a_ 10 48 7e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik A G 14: 44,170,442 S45P probably damaging Het
Adgrg4 C T X: 56,916,442 R1124C possibly damaging Het
Anxa13 T C 15: 58,356,203 noncoding transcript Het
Arhgap32 C A 9: 32,181,839 probably null Het
Carm1 T C 9: 21,569,526 F99L probably damaging Het
Dennd1b A G 1: 139,085,927 E253G possibly damaging Het
Dsg4 A G 18: 20,461,436 I541V probably benign Het
Dstyk A G 1: 132,434,389 T186A possibly damaging Het
Ear1 A T 14: 43,819,264 V49D probably benign Het
Epha10 A G 4: 124,915,687 probably benign Het
Fbxo18 A G 2: 11,749,017 V838A possibly damaging Het
Gm13023 G C 4: 143,793,983 E102Q probably benign Het
Golga1 T C 2: 39,023,454 I482V probably benign Het
Hivep3 G A 4: 119,733,793 probably benign Het
Igkv13-85 A G 6: 68,930,372 F82L probably damaging Het
Itih1 G A 14: 30,935,885 R410C probably damaging Het
Kcnc2 T C 10: 112,455,794 W296R probably damaging Het
Kcnq3 A T 15: 65,995,342 Y817* probably null Het
Kif3b T C 2: 153,323,644 probably null Het
Krtcap2 A G 3: 89,246,256 probably benign Het
Lhx5 C A 5: 120,440,008 H298N possibly damaging Het
Notch1 A G 2: 26,472,177 V1022A probably benign Het
Npc1l1 A G 11: 6,228,741 L223S possibly damaging Het
Olfr1258 C T 2: 89,930,351 P181S possibly damaging Het
Olfr160 C T 9: 37,711,464 V272I probably benign Het
Olfr279 T C 15: 98,498,134 F221L probably benign Het
Pbxip1 A G 3: 89,446,383 D281G possibly damaging Het
Pcdhga8 G C 18: 37,816,763 V411L probably damaging Het
Pcsk5 C T 19: 17,451,955 C1553Y probably damaging Het
Pdgfc A C 3: 81,174,991 M164L probably benign Het
Pdzd8 T C 19: 59,345,448 Y47C probably damaging Het
Pip5k1c T A 10: 81,315,111 I633N probably damaging Het
Pkn1 G A 8: 83,692,927 R16* probably null Het
Pole2 A G 12: 69,222,468 V85A probably benign Het
Ppp4c A C 7: 126,787,465 L150R probably damaging Het
Ric8a A G 7: 140,858,516 I223V probably benign Het
Rnf144a T A 12: 26,327,303 R92S probably benign Het
Sbno2 C A 10: 80,060,492 R898L possibly damaging Het
Scnn1b A C 7: 121,912,475 N370T probably damaging Het
Taar3 A G 10: 23,949,573 I6V possibly damaging Het
Vps13a T C 19: 16,695,502 E1302G possibly damaging Het
Other mutations in Fndc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Fndc8 APN 11 82898603 missense probably damaging 1.00
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R0066:Fndc8 UTSW 11 82897572 missense probably benign 0.38
R1827:Fndc8 UTSW 11 82899529 missense probably damaging 0.97
R2179:Fndc8 UTSW 11 82898754 missense probably damaging 1.00
R5401:Fndc8 UTSW 11 82897850 missense possibly damaging 0.80
R5889:Fndc8 UTSW 11 82898729 missense probably damaging 0.99
R5960:Fndc8 UTSW 11 82897572 missense probably benign 0.15
R6793:Fndc8 UTSW 11 82897586 missense probably damaging 1.00
R6798:Fndc8 UTSW 11 82892391 missense probably benign
R7210:Fndc8 UTSW 11 82897866 missense probably damaging 0.99
R7224:Fndc8 UTSW 11 82892325 missense probably benign 0.05
R7341:Fndc8 UTSW 11 82898777 missense possibly damaging 0.81
R7576:Fndc8 UTSW 11 82897574 missense probably damaging 1.00
R8190:Fndc8 UTSW 11 82897860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGATGGCGACGGTATTC -3'
(R):5'- AGTGAACCTCAGCTGGAAGG -3'

Sequencing Primer
(F):5'- ATGGCGACGGTATTCTGTAAAG -3'
(R):5'- GAATAGGAAGCACCCCCTGG -3'
Posted On2016-06-30