Incidental Mutation 'R4656:Ranbp2'
ID397259
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 041916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4656 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58453422 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 84 (K84R)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003310
AA Change: K84R

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: K84R

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220131
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (80/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik G A 10: 77,981,616 R59H probably benign Het
2310003L06Rik G A 5: 87,964,675 probably benign Het
4931406B18Rik T A 7: 43,501,141 H69L probably benign Het
Ace2 T C X: 164,153,114 S84P probably benign Het
Adgb A C 10: 10,405,306 N656K probably damaging Het
Ago3 G T 4: 126,363,752 Y495* probably null Het
Ahnak G A 19: 9,004,855 V1168M possibly damaging Het
Armc10 A G 5: 21,661,550 R271G probably benign Het
Atp4a T G 7: 30,719,948 probably benign Het
C87499 T C 4: 88,629,965 T68A probably benign Het
Casp1 C T 9: 5,304,324 P333S probably damaging Het
Ceacam9 C T 7: 16,723,649 A34V probably benign Het
Ces1b C G 8: 93,057,414 E488Q probably damaging Het
Ces2h A T 8: 105,014,639 T88S possibly damaging Het
Col2a1 C T 15: 97,976,176 G1375D unknown Het
Cyp1a1 T C 9: 57,702,610 F436L probably damaging Het
Dcaf7 T C 11: 106,053,798 V269A probably damaging Het
Disp2 T C 2: 118,790,563 L592P probably damaging Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Egln2 A G 7: 27,159,193 V408A probably benign Het
Gabpb2 A G 3: 95,188,941 L325P probably damaging Het
Gigyf1 C A 5: 137,525,215 Y936* probably null Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gnl2 C T 4: 125,040,997 Q149* probably null Het
Gpr107 C T 2: 31,214,249 T522M probably damaging Het
Grpr T A X: 163,514,996 S351C probably damaging Het
Gsdma T C 11: 98,673,081 L287P probably damaging Het
Herc1 A G 9: 66,394,711 T652A probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Irx2 T C 13: 72,631,298 S234P probably damaging Het
Itgal T A 7: 127,322,553 D808E probably damaging Het
Krt13 C A 11: 100,119,363 R264L probably damaging Het
March1 T A 8: 66,386,419 L38I probably benign Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Mif4gd G T 11: 115,608,337 probably benign Het
Mroh9 A T 1: 163,066,024 M194K probably damaging Het
Nhlrc3 A G 3: 53,463,080 S22P probably damaging Het
Nipal2 A T 15: 34,577,568 probably null Het
Nr1h4 A G 10: 89,498,253 S78P probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr390 A T 11: 73,787,511 D191V probably damaging Het
Olfr607 C T 7: 103,460,488 R235Q probably benign Het
Olfr908 A T 9: 38,516,556 N175Y probably damaging Het
Pdzd2 A G 15: 12,385,711 V991A probably benign Het
Pex1 G A 5: 3,604,880 probably null Het
Plch1 G T 3: 63,704,177 A859E probably damaging Het
Rbm14 T C 19: 4,811,435 Y25C probably damaging Het
Rmi2 A G 16: 10,835,322 D78G probably damaging Het
Serpina3k C A 12: 104,345,273 T370K probably damaging Het
Shc2 A T 10: 79,621,169 L538M probably damaging Het
Skint1 A G 4: 112,021,477 K202R probably damaging Het
Slc22a29 C A 19: 8,218,300 S125I possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco4c1 A T 1: 96,841,245 D297E probably benign Het
Slco6d1 T C 1: 98,423,203 F136S probably benign Het
Smg1 A T 7: 118,212,951 V39E probably benign Het
Spns1 G T 7: 126,374,302 probably benign Het
Spsb1 A G 4: 149,906,410 probably null Het
Sspo T G 6: 48,454,076 I631S possibly damaging Het
Syne2 T C 12: 76,031,373 L4694P probably damaging Het
Taf5l T C 8: 123,998,105 E325G probably benign Het
Tars A T 15: 11,394,264 S96T probably damaging Het
Tdrd12 T C 7: 35,485,254 K745E probably damaging Het
Tenm3 A G 8: 48,293,726 Y1015H probably damaging Het
Trpv3 T A 11: 73,295,414 M677K probably damaging Het
Txlnb A T 10: 17,815,276 K191N probably damaging Het
Ubr1 A G 2: 120,926,013 V711A probably benign Het
Uqcrb T C 13: 66,901,539 T41A probably benign Het
Usp6nl A G 2: 6,441,162 Y627C probably damaging Het
Vezf1 A G 11: 88,074,667 D245G probably damaging Het
Vmn2r66 A G 7: 85,011,996 W9R possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Wrn A T 8: 33,335,991 probably null Het
Zfy1 T G Y: 729,626 T339P unknown Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5294:Ranbp2 UTSW 10 58478668 missense probably benign 0.23
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
R7727:Ranbp2 UTSW 10 58455438 missense probably benign 0.09
R7795:Ranbp2 UTSW 10 58483907 nonsense probably null
R7812:Ranbp2 UTSW 10 58467402 missense probably benign
R7845:Ranbp2 UTSW 10 58447022 missense probably damaging 1.00
R7875:Ranbp2 UTSW 10 58478455 nonsense probably null
R7958:Ranbp2 UTSW 10 58478455 nonsense probably null
R8022:Ranbp2 UTSW 10 58485861 missense possibly damaging 0.53
R8050:Ranbp2 UTSW 10 58479619 missense probably damaging 0.99
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Z1176:Ranbp2 UTSW 10 58461886 missense probably damaging 1.00
Z1177:Ranbp2 UTSW 10 58493891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTAGCCAGTAATTGAGCTAC -3'
(R):5'- ACTTATTACAACCCCTGCAAGG -3'

Sequencing Primer
(F):5'- TGGTTTAGGCTGTAATCTACTATCAG -3'
(R):5'- CTGCGCACTATGTATGTGTCAG -3'
Posted On2016-06-30