Incidental Mutation 'R5166:Glcci1'
ID397294
Institutional Source Beutler Lab
Gene Symbol Glcci1
Ensembl Gene ENSMUSG00000029638
Gene Nameglucocorticoid induced transcript 1
SynonymsFam117c, GIG18, Tssn1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5166 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8509600-8597548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8537854 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 157 (S157R)
Ref Sequence ENSEMBL: ENSMUSP00000069444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064285] [ENSMUST00000161217] [ENSMUST00000161494] [ENSMUST00000162383] [ENSMUST00000162564] [ENSMUST00000162567]
Predicted Effect probably benign
Transcript: ENSMUST00000064285
AA Change: S157R

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069444
Gene: ENSMUSG00000029638
AA Change: S157R

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 22 48 N/A INTRINSIC
low complexity region 69 110 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
Pfam:FAM117 159 468 1.7e-132 PFAM
low complexity region 493 506 N/A INTRINSIC
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161217
SMART Domains Protein: ENSMUSP00000124167
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 284 3.2e-104 PFAM
low complexity region 305 318 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161494
SMART Domains Protein: ENSMUSP00000124595
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 237 1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162383
SMART Domains Protein: ENSMUSP00000125260
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 94 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162564
Predicted Effect probably benign
Transcript: ENSMUST00000162567
SMART Domains Protein: ENSMUSP00000125079
Gene: ENSMUSG00000029638

DomainStartEndE-ValueType
Pfam:FAM117 1 285 2.7e-100 PFAM
low complexity region 306 319 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,600,020 T435A probably benign Het
Adcy3 T A 12: 4,134,438 I38N probably damaging Het
Aff1 A G 5: 103,754,657 probably benign Het
Asxl1 A G 2: 153,401,121 E1197G probably damaging Het
Brinp3 T A 1: 146,901,367 N517K probably damaging Het
Carmil1 C T 13: 24,154,983 probably null Het
Ccdc185 G A 1: 182,748,999 Q42* probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh10 A G 15: 19,013,360 E682G probably damaging Het
Col6a3 C A 1: 90,810,608 R456L probably damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Flt4 T C 11: 49,633,257 probably null Het
Fstl5 A C 3: 76,628,960 K26Q possibly damaging Het
Gk5 G T 9: 96,174,768 A413S probably damaging Het
Gzmc G A 14: 56,233,976 A36V probably damaging Het
Hexb T C 13: 97,182,004 N283S probably benign Het
Hydin A G 8: 110,523,142 E2239G possibly damaging Het
Igkv10-95 A T 6: 68,680,560 Y20F probably benign Het
Il17re A G 6: 113,462,962 T181A probably benign Het
Kcnh6 G A 11: 106,020,319 A514T possibly damaging Het
Kcnk10 G A 12: 98,434,995 R460W probably damaging Het
Krtap5-2 A T 7: 142,174,984 S320T unknown Het
Larp1b G T 3: 40,964,052 E24* probably null Het
Mettl22 A G 16: 8,478,251 T135A probably benign Het
Mlh1 A G 9: 111,241,513 V378A probably benign Het
Mmrn1 A T 6: 60,976,490 H585L probably benign Het
Myh14 A G 7: 44,628,855 F1024L probably damaging Het
Nbea A T 3: 56,019,453 H776Q probably damaging Het
Nod2 A G 8: 88,664,247 D372G possibly damaging Het
Nptn C T 9: 58,618,980 R137* probably null Het
Olfr825 T C 10: 130,162,561 Y255C possibly damaging Het
Pm20d2 C T 4: 33,181,803 V267I probably benign Het
Rassf10 A G 7: 112,954,420 D76G probably benign Het
Rbbp5 A G 1: 132,490,565 T41A possibly damaging Het
Rttn T C 18: 89,013,094 V643A possibly damaging Het
Sbno2 C A 10: 80,066,928 E421* probably null Het
Slc17a3 T C 13: 23,842,542 probably null Het
Slc1a6 T A 10: 78,796,269 probably null Het
Slco2b1 A G 7: 99,689,013 S106P possibly damaging Het
Spef1 T C 2: 131,174,591 N28S probably damaging Het
Srebf2 C A 15: 82,185,402 T675N probably damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tbcd T A 11: 121,609,390 L1114H possibly damaging Het
Tex15 T C 8: 33,576,392 V1950A probably benign Het
Tnfsf9 T A 17: 57,106,263 F148Y possibly damaging Het
Traf6 A G 2: 101,690,057 D150G probably benign Het
Ttn A G 2: 76,863,373 Y262H possibly damaging Het
Unc93b1 A G 19: 3,944,027 Y386C probably damaging Het
Vmn1r226 A T 17: 20,687,863 E119V probably benign Het
Wrn A T 8: 33,352,072 probably null Het
Zfp398 A G 6: 47,865,904 I165V probably benign Het
Zfp850 A T 7: 27,990,356 C142* probably null Het
Other mutations in Glcci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Glcci1 APN 6 8579596 missense probably damaging 0.99
IGL02349:Glcci1 APN 6 8558581 missense probably damaging 1.00
IGL02877:Glcci1 APN 6 8582757 missense probably damaging 1.00
IGL03291:Glcci1 APN 6 8579678 missense probably damaging 1.00
R1084:Glcci1 UTSW 6 8573221 nonsense probably null
R1289:Glcci1 UTSW 6 8593088 missense possibly damaging 0.70
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1466:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1539:Glcci1 UTSW 6 8591620 missense probably damaging 1.00
R1584:Glcci1 UTSW 6 8537964 missense probably damaging 1.00
R1873:Glcci1 UTSW 6 8537837 missense probably benign 0.06
R1982:Glcci1 UTSW 6 8592980 missense probably damaging 1.00
R2043:Glcci1 UTSW 6 8582590 missense probably damaging 1.00
R2070:Glcci1 UTSW 6 8558566 missense probably damaging 1.00
R4834:Glcci1 UTSW 6 8582601 nonsense probably null
R5390:Glcci1 UTSW 6 8537835 missense probably benign 0.01
R6351:Glcci1 UTSW 6 8573203 nonsense probably null
X0065:Glcci1 UTSW 6 8591636 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTTGTGAGGCATGATGAAATG -3'
(R):5'- AAACAAGGGATGCTGCTTTGG -3'

Sequencing Primer
(F):5'- CCTAAAATAGTTGGGCTTTCAAGGG -3'
(R):5'- TGGTTGGGTTTATTTCATATTCAGG -3'
Posted On2016-07-06