Mutagenetix > Incidental Mutation

Incidental Mutation 'R5166:Mmrn1'

397296

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5166 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60976490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 585 (H585L)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000129603
AA Change: H585L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: H585L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204333
AA Change: H585L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: H585L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	T	C	5: 121,600,020	T435A	probably benign	Het
Adcy3	T	A	12: 4,134,438	I38N	probably damaging	Het
Aff1	A	G	5: 103,754,657		probably benign	Het
Asxl1	A	G	2: 153,401,121	E1197G	probably damaging	Het
Brinp3	T	A	1: 146,901,367	N517K	probably damaging	Het
Carmil1	C	T	13: 24,154,983		probably null	Het
Ccdc185	G	A	1: 182,748,999	Q42*	probably null	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdh10	A	G	15: 19,013,360	E682G	probably damaging	Het
Col6a3	C	A	1: 90,810,608	R456L	probably damaging	Het
Egf	C	T	3: 129,735,840	R307H	probably benign	Het
Flt4	T	C	11: 49,633,257		probably null	Het
Fstl5	A	C	3: 76,628,960	K26Q	possibly damaging	Het
Gk5	G	T	9: 96,174,768	A413S	probably damaging	Het
Glcci1	T	A	6: 8,537,854	S157R	probably benign	Het
Gzmc	G	A	14: 56,233,976	A36V	probably damaging	Het
Hexb	T	C	13: 97,182,004	N283S	probably benign	Het
Hydin	A	G	8: 110,523,142	E2239G	possibly damaging	Het
Igkv10-95	A	T	6: 68,680,560	Y20F	probably benign	Het
Il17re	A	G	6: 113,462,962	T181A	probably benign	Het
Kcnh6	G	A	11: 106,020,319	A514T	possibly damaging	Het
Kcnk10	G	A	12: 98,434,995	R460W	probably damaging	Het
Krtap5-2	A	T	7: 142,174,984	S320T	unknown	Het
Larp1b	G	T	3: 40,964,052	E24*	probably null	Het
Mettl22	A	G	16: 8,478,251	T135A	probably benign	Het
Mlh1	A	G	9: 111,241,513	V378A	probably benign	Het
Myh14	A	G	7: 44,628,855	F1024L	probably damaging	Het
Nbea	A	T	3: 56,019,453	H776Q	probably damaging	Het
Nod2	A	G	8: 88,664,247	D372G	possibly damaging	Het
Nptn	C	T	9: 58,618,980	R137*	probably null	Het
Olfr825	T	C	10: 130,162,561	Y255C	possibly damaging	Het
Pm20d2	C	T	4: 33,181,803	V267I	probably benign	Het
Rassf10	A	G	7: 112,954,420	D76G	probably benign	Het
Rbbp5	A	G	1: 132,490,565	T41A	possibly damaging	Het
Rttn	T	C	18: 89,013,094	V643A	possibly damaging	Het
Sbno2	C	A	10: 80,066,928	E421*	probably null	Het
Slc17a3	T	C	13: 23,842,542		probably null	Het
Slc1a6	T	A	10: 78,796,269		probably null	Het
Slco2b1	A	G	7: 99,689,013	S106P	possibly damaging	Het
Spef1	T	C	2: 131,174,591	N28S	probably damaging	Het
Srebf2	C	A	15: 82,185,402	T675N	probably damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Tbcd	T	A	11: 121,609,390	L1114H	possibly damaging	Het
Tex15	T	C	8: 33,576,392	V1950A	probably benign	Het
Tnfsf9	T	A	17: 57,106,263	F148Y	possibly damaging	Het
Traf6	A	G	2: 101,690,057	D150G	probably benign	Het
Ttn	A	G	2: 76,863,373	Y262H	possibly damaging	Het
Unc93b1	A	G	19: 3,944,027	Y386C	probably damaging	Het
Vmn1r226	A	T	17: 20,687,863	E119V	probably benign	Het
Wrn	A	T	8: 33,352,072		probably null	Het
Zfp398	A	G	6: 47,865,904	I165V	probably benign	Het
Zfp850	A	T	7: 27,990,356	C142*	probably null	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGAACAGAGAATGTCGCCAC -3'
(R):5'- TGTTGAAGCGACGACCTCTG -3'

Sequencing Primer
(F):5'- ATGTCGCCACTGAGGAATC -3'
(R):5'- ACGACCTCTGCTCCAGC -3'

Posted On

2016-07-06