Incidental Mutation 'R5166:Zfp850'
ID397299
Institutional Source Beutler Lab
Gene Symbol Zfp850
Ensembl Gene ENSMUSG00000096916
Gene Namezinc finger protein 850
SynonymsC130069I09Rik, Gm4636
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5166 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27984854-28014115 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27990356 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 142 (C142*)
Ref Sequence ENSEMBL: ENSMUSP00000141063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099111] [ENSMUST00000180024] [ENSMUST00000180502]
Predicted Effect probably benign
Transcript: ENSMUST00000099111
Predicted Effect probably null
Transcript: ENSMUST00000180024
AA Change: C142*
SMART Domains Protein: ENSMUSP00000137192
Gene: ENSMUSG00000096916
AA Change: C142*

DomainStartEndE-ValueType
KRAB 14 75 1.56e-34 SMART
ZnF_C2H2 172 194 7.18e1 SMART
ZnF_C2H2 200 222 3.63e-3 SMART
ZnF_C2H2 228 250 8.94e-3 SMART
ZnF_C2H2 256 278 7.49e-5 SMART
ZnF_C2H2 313 335 1.01e-1 SMART
ZnF_C2H2 341 363 4.4e-2 SMART
ZnF_C2H2 369 391 7.37e-4 SMART
ZnF_C2H2 397 419 8.47e-4 SMART
ZnF_C2H2 425 447 1.92e-2 SMART
ZnF_C2H2 453 475 2.99e-4 SMART
ZnF_C2H2 481 503 7.78e-3 SMART
ZnF_C2H2 509 531 1.95e-3 SMART
ZnF_C2H2 537 559 1.92e-2 SMART
ZnF_C2H2 565 587 2.99e-4 SMART
ZnF_C2H2 593 615 1.79e-2 SMART
ZnF_C2H2 621 643 7.37e-4 SMART
ZnF_C2H2 649 671 4.4e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180502
AA Change: C142*
SMART Domains Protein: ENSMUSP00000141063
Gene: ENSMUSG00000096916
AA Change: C142*

DomainStartEndE-ValueType
KRAB 14 75 6.5e-37 SMART
ZnF_C2H2 172 194 3e-1 SMART
ZnF_C2H2 200 222 1.5e-5 SMART
ZnF_C2H2 228 250 3.8e-5 SMART
ZnF_C2H2 256 274 2.5e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 T C 5: 121,600,020 T435A probably benign Het
Adcy3 T A 12: 4,134,438 I38N probably damaging Het
Aff1 A G 5: 103,754,657 probably benign Het
Asxl1 A G 2: 153,401,121 E1197G probably damaging Het
Brinp3 T A 1: 146,901,367 N517K probably damaging Het
Carmil1 C T 13: 24,154,983 probably null Het
Ccdc185 G A 1: 182,748,999 Q42* probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh10 A G 15: 19,013,360 E682G probably damaging Het
Col6a3 C A 1: 90,810,608 R456L probably damaging Het
Egf C T 3: 129,735,840 R307H probably benign Het
Flt4 T C 11: 49,633,257 probably null Het
Fstl5 A C 3: 76,628,960 K26Q possibly damaging Het
Gk5 G T 9: 96,174,768 A413S probably damaging Het
Glcci1 T A 6: 8,537,854 S157R probably benign Het
Gzmc G A 14: 56,233,976 A36V probably damaging Het
Hexb T C 13: 97,182,004 N283S probably benign Het
Hydin A G 8: 110,523,142 E2239G possibly damaging Het
Igkv10-95 A T 6: 68,680,560 Y20F probably benign Het
Il17re A G 6: 113,462,962 T181A probably benign Het
Kcnh6 G A 11: 106,020,319 A514T possibly damaging Het
Kcnk10 G A 12: 98,434,995 R460W probably damaging Het
Krtap5-2 A T 7: 142,174,984 S320T unknown Het
Larp1b G T 3: 40,964,052 E24* probably null Het
Mettl22 A G 16: 8,478,251 T135A probably benign Het
Mlh1 A G 9: 111,241,513 V378A probably benign Het
Mmrn1 A T 6: 60,976,490 H585L probably benign Het
Myh14 A G 7: 44,628,855 F1024L probably damaging Het
Nbea A T 3: 56,019,453 H776Q probably damaging Het
Nod2 A G 8: 88,664,247 D372G possibly damaging Het
Nptn C T 9: 58,618,980 R137* probably null Het
Olfr825 T C 10: 130,162,561 Y255C possibly damaging Het
Pm20d2 C T 4: 33,181,803 V267I probably benign Het
Rassf10 A G 7: 112,954,420 D76G probably benign Het
Rbbp5 A G 1: 132,490,565 T41A possibly damaging Het
Rttn T C 18: 89,013,094 V643A possibly damaging Het
Sbno2 C A 10: 80,066,928 E421* probably null Het
Slc17a3 T C 13: 23,842,542 probably null Het
Slc1a6 T A 10: 78,796,269 probably null Het
Slco2b1 A G 7: 99,689,013 S106P possibly damaging Het
Spef1 T C 2: 131,174,591 N28S probably damaging Het
Srebf2 C A 15: 82,185,402 T675N probably damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tbcd T A 11: 121,609,390 L1114H possibly damaging Het
Tex15 T C 8: 33,576,392 V1950A probably benign Het
Tnfsf9 T A 17: 57,106,263 F148Y possibly damaging Het
Traf6 A G 2: 101,690,057 D150G probably benign Het
Ttn A G 2: 76,863,373 Y262H possibly damaging Het
Unc93b1 A G 19: 3,944,027 Y386C probably damaging Het
Vmn1r226 A T 17: 20,687,863 E119V probably benign Het
Wrn A T 8: 33,352,072 probably null Het
Zfp398 A G 6: 47,865,904 I165V probably benign Het
Other mutations in Zfp850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02278:Zfp850 APN 7 28008397 missense probably damaging 0.96
R0610:Zfp850 UTSW 7 27989394 missense probably damaging 0.99
R0690:Zfp850 UTSW 7 27985217 missense possibly damaging 0.67
R0711:Zfp850 UTSW 7 27990273 missense probably benign 0.00
R1310:Zfp850 UTSW 7 27989459 missense probably benign 0.40
R1594:Zfp850 UTSW 7 27989391 missense probably benign 0.00
R1771:Zfp850 UTSW 7 27985275 nonsense probably null
R2189:Zfp850 UTSW 7 27989055 missense probably benign 0.02
R2192:Zfp850 UTSW 7 27985195 missense probably damaging 1.00
R2417:Zfp850 UTSW 7 27989183 missense possibly damaging 0.54
R4321:Zfp850 UTSW 7 27989400 missense probably damaging 0.99
R4770:Zfp850 UTSW 7 27984986 unclassified probably null
R4970:Zfp850 UTSW 7 27990233 nonsense probably null
R5112:Zfp850 UTSW 7 27990233 nonsense probably null
R5303:Zfp850 UTSW 7 28008413 missense probably damaging 1.00
R5315:Zfp850 UTSW 7 27990318 missense probably benign 0.02
R5496:Zfp850 UTSW 7 28007346 missense probably damaging 0.98
R5547:Zfp850 UTSW 7 27989419 missense probably damaging 1.00
R5677:Zfp850 UTSW 7 27989088 missense probably damaging 1.00
R5927:Zfp850 UTSW 7 27990195 missense probably benign 0.17
R6654:Zfp850 UTSW 7 27985215 nonsense probably null
R6950:Zfp850 UTSW 7 27990514 missense possibly damaging 0.86
R6987:Zfp850 UTSW 7 27990001 missense probably damaging 1.00
R6990:Zfp850 UTSW 7 27990376 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCTAGAACAGTGAAGGCAC -3'
(R):5'- TCTCGGAAAATGCTTTAGAGTCAG -3'

Sequencing Primer
(F):5'- CTGCCACATTCTTTACACTGAAAGGG -3'
(R):5'- AATGCTTTAGAGTCAGGCTATTTTG -3'
Posted On2016-07-06