Mutagenetix > Incidental Mutations

Incidental Mutation 'R5166:Tbcd'

397317

Institutional Source

Beutler Lab

Gene Symbol

Tbcd

Ensembl Gene

ENSMUSG00000039230

Gene Name

tubulin-specific chaperone d

Synonyms

2310057L06Rik, A030005L14Rik

Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R5166 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121451949-121617164 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121609390 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1114 (L1114H)

Ref Sequence

ENSEMBL: ENSMUSP00000099302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103013]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103013
AA Change: L1114H

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230
AA Change: L1114H

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
low complexity region	45	62	N/A	INTRINSIC
SCOP:d1b3ua_	357	742	4e-20	SMART
Pfam:TFCD_C	900	1090	1.4e-74	PFAM
low complexity region	1113	1120	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139414

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151666

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155666

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad12	T	C	5: 121,600,020	T435A	probably benign	Het
Adcy3	T	A	12: 4,134,438	I38N	probably damaging	Het
Aff1	A	G	5: 103,754,657		probably benign	Het
Asxl1	A	G	2: 153,401,121	E1197G	probably damaging	Het
Brinp3	T	A	1: 146,901,367	N517K	probably damaging	Het
Carmil1	C	T	13: 24,154,983		probably null	Het
Ccdc185	G	A	1: 182,748,999	Q42*	probably null	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdh10	A	G	15: 19,013,360	E682G	probably damaging	Het
Col6a3	C	A	1: 90,810,608	R456L	probably damaging	Het
Egf	C	T	3: 129,735,840	R307H	probably benign	Het
Flt4	T	C	11: 49,633,257		probably null	Het
Fstl5	A	C	3: 76,628,960	K26Q	possibly damaging	Het
Gk5	G	T	9: 96,174,768	A413S	probably damaging	Het
Glcci1	T	A	6: 8,537,854	S157R	probably benign	Het
Gzmc	G	A	14: 56,233,976	A36V	probably damaging	Het
Hexb	T	C	13: 97,182,004	N283S	probably benign	Het
Hydin	A	G	8: 110,523,142	E2239G	possibly damaging	Het
Igkv10-95	A	T	6: 68,680,560	Y20F	probably benign	Het
Il17re	A	G	6: 113,462,962	T181A	probably benign	Het
Kcnh6	G	A	11: 106,020,319	A514T	possibly damaging	Het
Kcnk10	G	A	12: 98,434,995	R460W	probably damaging	Het
Krtap5-2	A	T	7: 142,174,984	S320T	unknown	Het
Larp1b	G	T	3: 40,964,052	E24*	probably null	Het
Mettl22	A	G	16: 8,478,251	T135A	probably benign	Het
Mlh1	A	G	9: 111,241,513	V378A	probably benign	Het
Mmrn1	A	T	6: 60,976,490	H585L	probably benign	Het
Myh14	A	G	7: 44,628,855	F1024L	probably damaging	Het
Nbea	A	T	3: 56,019,453	H776Q	probably damaging	Het
Nod2	A	G	8: 88,664,247	D372G	possibly damaging	Het
Nptn	C	T	9: 58,618,980	R137*	probably null	Het
Olfr825	T	C	10: 130,162,561	Y255C	possibly damaging	Het
Pm20d2	C	T	4: 33,181,803	V267I	probably benign	Het
Rassf10	A	G	7: 112,954,420	D76G	probably benign	Het
Rbbp5	A	G	1: 132,490,565	T41A	possibly damaging	Het
Rttn	T	C	18: 89,013,094	V643A	possibly damaging	Het
Sbno2	C	A	10: 80,066,928	E421*	probably null	Het
Slc17a3	T	C	13: 23,842,542		probably null	Het
Slc1a6	T	A	10: 78,796,269		probably null	Het
Slco2b1	A	G	7: 99,689,013	S106P	possibly damaging	Het
Spef1	T	C	2: 131,174,591	N28S	probably damaging	Het
Srebf2	C	A	15: 82,185,402	T675N	probably damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Tex15	T	C	8: 33,576,392	V1950A	probably benign	Het
Tnfsf9	T	A	17: 57,106,263	F148Y	possibly damaging	Het
Traf6	A	G	2: 101,690,057	D150G	probably benign	Het
Ttn	A	G	2: 76,863,373	Y262H	possibly damaging	Het
Unc93b1	A	G	19: 3,944,027	Y386C	probably damaging	Het
Vmn1r226	A	T	17: 20,687,863	E119V	probably benign	Het
Wrn	A	T	8: 33,352,072		probably null	Het
Zfp398	A	G	6: 47,865,904	I165V	probably benign	Het
Zfp850	A	T	7: 27,990,356	C142*	probably null	Het

Other mutations in Tbcd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Tbcd	APN	11	121575321	missense	probably damaging	0.96
IGL00795:Tbcd	APN	11	121616932	missense	probably benign
IGL00802:Tbcd	APN	11	121608610	missense	possibly damaging	0.55
IGL01286:Tbcd	APN	11	121493893	critical splice donor site	probably null
IGL01325:Tbcd	APN	11	121540993	missense	probably damaging	0.99
IGL01348:Tbcd	APN	11	121497076	missense	probably benign
IGL01432:Tbcd	APN	11	121475680	splice site	probably benign
IGL01577:Tbcd	APN	11	121497012	missense	probably damaging	1.00
IGL01660:Tbcd	APN	11	121605327	missense	probably benign	0.01
IGL01865:Tbcd	APN	11	121590380	missense	possibly damaging	0.81
IGL02260:Tbcd	APN	11	121603278	missense	probably damaging	1.00
IGL02492:Tbcd	APN	11	121497134	missense	probably benign	0.06
IGL02620:Tbcd	APN	11	121461255	missense	probably damaging	1.00
IGL02950:Tbcd	APN	11	121603709	missense	probably damaging	0.99
R6859_Tbcd_818	UTSW	11	121497111	missense	possibly damaging	0.81
R0066:Tbcd	UTSW	11	121503764	nonsense	probably null
R0066:Tbcd	UTSW	11	121503764	nonsense	probably null
R0077:Tbcd	UTSW	11	121594274	missense	probably benign	0.00
R0349:Tbcd	UTSW	11	121602983	splice site	probably null
R0865:Tbcd	UTSW	11	121602989	missense	possibly damaging	0.88
R1203:Tbcd	UTSW	11	121475625	missense	probably benign	0.00
R1221:Tbcd	UTSW	11	121497083	missense	probably benign	0.00
R1549:Tbcd	UTSW	11	121560753	missense	probably benign
R1586:Tbcd	UTSW	11	121497060	missense	probably benign	0.13
R1671:Tbcd	UTSW	11	121597294	missense	probably benign	0.00
R2048:Tbcd	UTSW	11	121540936	missense	probably damaging	1.00
R2051:Tbcd	UTSW	11	121453670	missense	probably damaging	1.00
R2124:Tbcd	UTSW	11	121603320	missense	probably damaging	1.00
R2151:Tbcd	UTSW	11	121603631	missense	possibly damaging	0.95
R2153:Tbcd	UTSW	11	121603631	missense	possibly damaging	0.95
R3120:Tbcd	UTSW	11	121608648	missense	probably damaging	0.97
R4108:Tbcd	UTSW	11	121493811	missense	probably benign	0.00
R4244:Tbcd	UTSW	11	121594281	missense	probably damaging	1.00
R4587:Tbcd	UTSW	11	121605271	missense	possibly damaging	0.75
R4684:Tbcd	UTSW	11	121493771	missense	probably damaging	1.00
R4837:Tbcd	UTSW	11	121582785	critical splice donor site	probably null
R4861:Tbcd	UTSW	11	121601961	missense	probably damaging	1.00
R4861:Tbcd	UTSW	11	121601961	missense	probably damaging	1.00
R4960:Tbcd	UTSW	11	121573855	missense	probably benign	0.03
R5157:Tbcd	UTSW	11	121610027	missense	probably benign	0.14
R5403:Tbcd	UTSW	11	121560743	missense	probably damaging	0.99
R5406:Tbcd	UTSW	11	121452101	missense	probably benign
R5509:Tbcd	UTSW	11	121602012	missense	probably benign	0.00
R5767:Tbcd	UTSW	11	121592692	missense	probably benign	0.00
R5923:Tbcd	UTSW	11	121580152	missense	probably benign
R5966:Tbcd	UTSW	11	121601911	intron	probably benign
R6330:Tbcd	UTSW	11	121497086	missense	probably benign
R6539:Tbcd	UTSW	11	121556987	critical splice donor site	probably null
R6852:Tbcd	UTSW	11	121609380	missense	probably benign	0.36
R6859:Tbcd	UTSW	11	121497111	missense	possibly damaging	0.81
R7348:Tbcd	UTSW	11	121594311	missense	probably benign	0.22
R7479:Tbcd	UTSW	11	121492605	critical splice donor site	probably null
R7679:Tbcd	UTSW	11	121603708	missense	probably benign	0.01
R8121:Tbcd	UTSW	11	121597143	splice site	probably null
R8163:Tbcd	UTSW	11	121493885	missense	probably benign	0.00
R8165:Tbcd	UTSW	11	121493885	missense	probably benign	0.00
R8172:Tbcd	UTSW	11	121493885	missense	probably benign	0.00
Z1177:Tbcd	UTSW	11	121590406	missense	probably null	0.14

Predicted Primers

PCR Primer
(F):5'- TAGCATAGGTCACATGGGAGC -3'
(R):5'- GTGTTCCTTTCATACAAACACCAAC -3'

Sequencing Primer
(F):5'- TCACATGGGAGCGCACTAGTG -3'
(R):5'- CCAGTTGACTGCCCACAC -3'

Posted On

2016-07-06