Incidental Mutation 'R5167:Fbxo28'
ID397336
Institutional Source Beutler Lab
Gene Symbol Fbxo28
Ensembl Gene ENSMUSG00000047539
Gene NameF-box protein 28
SynonymsD1Ertd578e, 4833428J17Rik, Fbx28, 5730505P19Rik
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location182313102-182341629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 182317993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 177 (I177V)
Ref Sequence ENSEMBL: ENSMUSP00000054718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051431] [ENSMUST00000192544] [ENSMUST00000194213] [ENSMUST00000195061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051431
AA Change: I177V

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054718
Gene: ENSMUSG00000047539
AA Change: I177V

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:F-box 63 94 7.8e-6 PFAM
coiled coil region 273 332 N/A INTRINSIC
low complexity region 335 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192544
SMART Domains Protein: ENSMUSP00000141838
Gene: ENSMUSG00000047539

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:F-box 62 101 8.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193700
Predicted Effect probably benign
Transcript: ENSMUST00000194213
SMART Domains Protein: ENSMUSP00000141219
Gene: ENSMUSG00000047539

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:F-box 63 101 2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195061
SMART Domains Protein: ENSMUSP00000141772
Gene: ENSMUSG00000047539

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:F-box 56 95 1.1e-5 PFAM
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO28, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Fbxo28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Fbxo28 APN 1 182317012 missense probably damaging 0.96
IGL02936:Fbxo28 APN 1 182341528 missense unknown
IGL03269:Fbxo28 APN 1 182317018 missense possibly damaging 0.50
R0040:Fbxo28 UTSW 1 182326240 intron probably benign
R0394:Fbxo28 UTSW 1 182317015 missense probably benign 0.31
R1800:Fbxo28 UTSW 1 182341534 missense unknown
R1846:Fbxo28 UTSW 1 182326280 missense probably benign 0.02
R1891:Fbxo28 UTSW 1 182317824 missense probably benign 0.35
R2113:Fbxo28 UTSW 1 182329925 missense probably damaging 0.99
R2698:Fbxo28 UTSW 1 182317154 missense probably benign 0.09
R4022:Fbxo28 UTSW 1 182329910 missense possibly damaging 0.91
R4952:Fbxo28 UTSW 1 182326385 missense probably damaging 1.00
R6196:Fbxo28 UTSW 1 182329889 missense probably damaging 0.99
R6233:Fbxo28 UTSW 1 182341508 missense unknown
R6920:Fbxo28 UTSW 1 182341421 missense probably benign 0.23
R6935:Fbxo28 UTSW 1 182341460 missense unknown
R7557:Fbxo28 UTSW 1 182341435 missense unknown
Z1176:Fbxo28 UTSW 1 182317870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCATGAGTCTTCCTGAC -3'
(R):5'- CTTTAGCACAGTACCCTGGAAC -3'

Sequencing Primer
(F):5'- GACACATCTGATCCTGGCAATTTC -3'
(R):5'- GCAACTCTAAGATGGTAGCC -3'
Posted On2016-07-06