Incidental Mutation 'R5167:Olfr1307'
ID397337
Institutional Source Beutler Lab
Gene Symbol Olfr1307
Ensembl Gene ENSMUSG00000094747
Gene Nameolfactory receptor 1307
SynonymsMOR245-19P, GA_x6K02T2Q125-72988111-72987173
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111930116-111949440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111945102 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000097201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]
Predicted Effect probably damaging
Transcript: ENSMUST00000099604
AA Change: M118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099606
AA Change: M118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: M118K

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-42 PFAM
Pfam:7tm_1 41 287 6.7e-23 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Olfr1307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Olfr1307 APN 2 111944518 makesense probably null
IGL01947:Olfr1307 APN 2 111944994 missense probably benign 0.26
IGL02373:Olfr1307 APN 2 111944833 missense probably benign 0.01
IGL02682:Olfr1307 APN 2 111944940 missense probably damaging 1.00
R0714:Olfr1307 UTSW 2 111944553 missense probably benign 0.01
R1670:Olfr1307 UTSW 2 111944919 missense probably damaging 1.00
R1730:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R1733:Olfr1307 UTSW 2 111945280 missense probably benign 0.13
R1773:Olfr1307 UTSW 2 111944859 missense possibly damaging 0.55
R1783:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R2180:Olfr1307 UTSW 2 111945003 missense probably benign 0.39
R2197:Olfr1307 UTSW 2 111945313 missense possibly damaging 0.64
R2207:Olfr1307 UTSW 2 111944925 missense probably damaging 1.00
R2377:Olfr1307 UTSW 2 111944643 missense probably damaging 1.00
R4425:Olfr1307 UTSW 2 111945189 missense probably benign 0.00
R4595:Olfr1307 UTSW 2 111944652 missense possibly damaging 0.86
R4859:Olfr1307 UTSW 2 111944811 missense probably damaging 0.98
R4910:Olfr1307 UTSW 2 111945078 missense possibly damaging 0.69
R5537:Olfr1307 UTSW 2 111945048 missense probably damaging 1.00
R6328:Olfr1307 UTSW 2 111945394 missense probably null 0.41
R6877:Olfr1307 UTSW 2 111944839 missense probably benign 0.16
R7011:Olfr1307 UTSW 2 111944686 missense probably benign 0.01
R7177:Olfr1307 UTSW 2 111945156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGAAGCTGTCCAACACATTTG -3'
(R):5'- CGTGTTCACTGTGGCATCTG -3'

Sequencing Primer
(F):5'- ACAAGATGCATGTCCTCG -3'
(R):5'- GTGGCATCTGACCCTCAC -3'
Posted On2016-07-06