Mutagenetix > Incidental Mutations

Incidental Mutation 'R5167:Knl1'

397338

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

2310043D08Rik, 5730505K17Rik

MMRRC Submission

042747-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5167 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119047119-119105501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119070031 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 738 (I738V)

Ref Sequence

ENSEMBL: ENSMUSP00000097140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028799
AA Change: I738V

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: I738V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000028802
AA Change: I738V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: I738V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000099542
AA Change: I738V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: I738V

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153300

SMART Domains

Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC

Meta Mutation Damage Score

0.1115

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Calm3	T	C	7: 16,917,701	D21G	probably damaging	Het
Cldn23	C	T	8: 35,826,320	V5M	possibly damaging	Het
D630003M21Rik	A	G	2: 158,205,745	S735P	probably damaging	Het
Dscaml1	T	C	9: 45,717,432	Y1095H	probably damaging	Het
Esr2	T	C	12: 76,123,274	T427A	probably benign	Het
Fbxo28	T	C	1: 182,317,993	I177V	possibly damaging	Het
Fubp1	T	C	3: 152,221,352	L372P	possibly damaging	Het
Glis1	G	A	4: 107,634,694	G585E	probably damaging	Het
Gm7258	T	C	7: 128,596,067		noncoding transcript	Het
Hecw1	C	T	13: 14,285,657	R613Q	probably damaging	Het
Kif13b	T	C	14: 64,772,935	S1228P	probably damaging	Het
Lig1	T	A	7: 13,311,058	V892D	probably damaging	Het
Lvrn	T	A	18: 46,880,747	Y499N	probably damaging	Het
Ly9	C	A	1: 171,605,205	W80L	probably damaging	Het
Lypd5	T	C	7: 24,352,464	V68A	possibly damaging	Het
Ngdn	C	T	14: 55,022,199	Q236*	probably null	Het
Nudt7	C	A	8: 114,151,827	C154*	probably null	Het
Olfr116	C	A	17: 37,623,751	E295*	probably null	Het
Olfr1307	A	T	2: 111,945,102	M118K	probably damaging	Het
Olfr1472	T	A	19: 13,454,377	I47F	probably damaging	Het
Paxbp1	A	G	16: 91,022,667		probably null	Het
Pcnt	G	T	10: 76,420,424	Q661K	probably damaging	Het
Plekha1	G	A	7: 130,885,449		probably null	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Rac3	A	G	11: 120,722,595	D58G	probably null	Het
Rgl2	C	T	17: 33,935,974	R203*	probably null	Het
Rnf219	A	G	14: 104,478,787	S717P	probably damaging	Het
Ryr1	T	C	7: 29,067,693	D2948G	probably damaging	Het
Serpina12	A	T	12: 104,037,920	L151Q	probably damaging	Het
Sf3a1	T	C	11: 4,177,456	V594A	possibly damaging	Het
Spdl1	G	T	11: 34,813,360	H549N	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Zfp352	A	G	4: 90,224,216	T198A	possibly damaging	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	119064083	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	119102499	missense	probably benign	0.19
IGL00666:Knl1	APN	2	119070464	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	119076980	missense	probably benign	0.33
IGL01395:Knl1	APN	2	119071566	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	119070001	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	119104061	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	119100774	missense	probably benign	0.40
IGL02105:Knl1	APN	2	119071808	missense	probably benign
IGL02106:Knl1	APN	2	119072008	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	119069152	missense	probably benign	0.01
IGL02252:Knl1	APN	2	119072540	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	119070323	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	119070992	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	119077969	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	119070930	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	119088831	missense	probably benign	0.08
IGL03100:Knl1	APN	2	119100770	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	119070617	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	119072359	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	119102549	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0078:Knl1	UTSW	2	119069892	missense	probably benign	0.16
R0178:Knl1	UTSW	2	119058405	splice site	probably benign
R0295:Knl1	UTSW	2	119088839	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	119104061	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	119068388	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	119097435	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	119088901	splice site	probably benign
R0920:Knl1	UTSW	2	119069828	missense	probably benign	0.00
R1120:Knl1	UTSW	2	119062375	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	119071154	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	119071189	missense	probably benign	0.00
R1241:Knl1	UTSW	2	119072573	missense	probably benign	0.03
R1387:Knl1	UTSW	2	119070730	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	119068307	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	119071738	missense	probably benign	0.01
R1721:Knl1	UTSW	2	119076334	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	119071819	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	119087594	critical splice donor site	probably null
R2227:Knl1	UTSW	2	119072000	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	119072227	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	119072281	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	119058368	nonsense	probably null
R3115:Knl1	UTSW	2	119070391	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	119068944	missense	probably benign	0.32
R3431:Knl1	UTSW	2	119062362	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	119102579	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	119059599	missense	probably benign	0.00
R4600:Knl1	UTSW	2	119070544	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	119069137	nonsense	probably null
R4758:Knl1	UTSW	2	119071732	frame shift	probably null
R4762:Knl1	UTSW	2	119071936	missense	probably benign	0.01
R4869:Knl1	UTSW	2	119072351	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	119081513	missense	probably benign	0.22
R4935:Knl1	UTSW	2	119068957	missense	possibly damaging	0.50
R5184:Knl1	UTSW	2	119069176	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	119069695	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	119070255	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	119070983	missense	probably benign	0.01
R5493:Knl1	UTSW	2	119068730	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	119070352	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	119081550	nonsense	probably null
R5854:Knl1	UTSW	2	119070403	missense	probably benign	0.02
R5979:Knl1	UTSW	2	119069360	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	119094068	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	119070286	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	119071941	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	119069318	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	119069003	missense	probably benign	0.02
R6608:Knl1	UTSW	2	119086612	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	119095184	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	119070785	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	119069299	missense	probably benign	0.35
R7270:Knl1	UTSW	2	119102522	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	119071686	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	119070559	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	119095226	nonsense	probably null
R7408:Knl1	UTSW	2	119070592	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	119087546	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	119070698	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	119065979	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	119094006	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	119095133	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	119071556	missense	probably benign	0.13
R7847:Knl1	UTSW	2	119070976	missense	probably benign	0.02
R7930:Knl1	UTSW	2	119070976	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCATACAAACAGCTGTGAACG -3'
(R):5'- TCACCAGGAGTTATATCACTGGG -3'

Sequencing Primer
(F):5'- AACAGCTGTGAACGTTCCTG -3'
(R):5'- CACTGGGCGAGATAATTTTACATTC -3'

Posted On

2016-07-06