Incidental Mutation 'R5167:Zfp352'
ID397343
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Namezinc finger protein 352
Synonyms2czf48
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location90218820-90225702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90224216 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080541
AA Change: T198A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: T198A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107129
AA Change: T198A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: T198A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90224154 missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90224130 missense probably benign 0.02
IGL03156:Zfp352 APN 4 90224087 missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90224702 missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90223757 missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90224346 missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90224285 missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90225009 missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90224690 missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90223919 missense probably benign
R1034:Zfp352 UTSW 4 90224156 missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90223809 missense probably benign 0.23
R2016:Zfp352 UTSW 4 90225171 missense probably benign 0.42
R2064:Zfp352 UTSW 4 90225120 missense probably benign 0.08
R2308:Zfp352 UTSW 4 90225243 missense probably benign 0.00
R3552:Zfp352 UTSW 4 90225102 missense probably benign 0.33
R3794:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90225024 missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90223834 missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90225164 missense probably benign 0.00
R4590:Zfp352 UTSW 4 90224535 missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4617:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4618:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4741:Zfp352 UTSW 4 90224940 missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90224304 missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R4973:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R5260:Zfp352 UTSW 4 90224460 missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90225104 missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90225070 missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90225200 missense probably benign 0.33
R6819:Zfp352 UTSW 4 90224699 missense probably benign
R7072:Zfp352 UTSW 4 90224424 missense probably benign 0.00
R7099:Zfp352 UTSW 4 90224880 missense probably benign 0.00
R7569:Zfp352 UTSW 4 90223659 missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90224777 missense probably benign 0.13
R7705:Zfp352 UTSW 4 90225275 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGACACTGAACTCTGACAAG -3'
(R):5'- AGTTAGCTCTCATCTGAGGCTC -3'

Sequencing Primer
(F):5'- GGACACTGAACTCTGACAAGACTCTC -3'
(R):5'- GCTCTCATCTGAGGCTCATAGAAAG -3'
Posted On2016-07-06