Incidental Mutation 'R5167:Calm3'
ID397347
Institutional Source Beutler Lab
Gene Symbol Calm3
Ensembl Gene ENSMUSG00000019370
Gene Namecalmodulin 3
Synonyms
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16915379-16924114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16917701 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 21 (D21G)
Ref Sequence ENSEMBL: ENSMUSP00000019514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019514] [ENSMUST00000172594]
PDB Structure
3-D structure of Myosin-V inhibited state [ELECTRON CRYSTALLOGRAPHY]
Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of Nav1.6 IQ motif in complex with apo-CaM [X-RAY DIFFRACTION]
Calmodulin and Ng peptide complex [X-RAY DIFFRACTION]
Calmodulin and Nm peptide complex [X-RAY DIFFRACTION]
A novel conformation of calmodulin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000019514
AA Change: D21G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019514
Gene: ENSMUSG00000019370
AA Change: D21G

DomainStartEndE-ValueType
EFh 12 40 6.39e-9 SMART
EFh 48 76 5.19e-9 SMART
EFh 85 113 3.67e-9 SMART
EFh 121 149 1.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172594
Predicted Effect probably benign
Transcript: ENSMUST00000173139
SMART Domains Protein: ENSMUSP00000134395
Gene: ENSMUSG00000019370

DomainStartEndE-ValueType
PDB:1YRU|B 2 32 2e-15 PDB
SCOP:d2mysb_ 2 32 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173557
Meta Mutation Damage Score 0.9580 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Calm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Calm3 APN 7 16917484 missense probably benign 0.00
R5462:Calm3 UTSW 7 16917694 missense possibly damaging 0.93
R6615:Calm3 UTSW 7 16917583 critical splice donor site probably null
R6870:Calm3 UTSW 7 16919643 missense probably benign 0.01
R7090:Calm3 UTSW 7 16917079 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGTCCCATTGCCTAGCAG -3'
(R):5'- TGGTCCAGTGCATCATTTGAG -3'

Sequencing Primer
(F):5'- GCATGTGCTGCCTGGAG -3'
(R):5'- TCCAGTGCATCATTTGAGAGAGAG -3'
Posted On2016-07-06