Incidental Mutation 'R5167:Lypd5'
ID397348
Institutional Source Beutler Lab
Gene Symbol Lypd5
Ensembl Gene ENSMUSG00000030484
Gene NameLy6/Plaur domain containing 5
Synonyms
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24349196-24355109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24352464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 68 (V68A)
Ref Sequence ENSEMBL: ENSMUSP00000032683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032683]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032683
AA Change: V68A

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032683
Gene: ENSMUSG00000030484
AA Change: V68A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:LU 24 119 7e-38 BLAST
LU 132 225 1.19e-1 SMART
low complexity region 230 248 N/A INTRINSIC
Meta Mutation Damage Score 0.1727 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Lypd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lypd5 APN 7 24353485 missense probably benign 0.10
IGL01121:Lypd5 APN 7 24351551 missense probably benign
IGL01689:Lypd5 APN 7 24352629 splice site probably benign
IGL02584:Lypd5 APN 7 24353568 missense possibly damaging 0.59
IGL02888:Lypd5 APN 7 24352619 missense probably damaging 0.98
R5982:Lypd5 UTSW 7 24353037 missense probably damaging 1.00
R6746:Lypd5 UTSW 7 24353106 splice site probably null
R7951:Lypd5 UTSW 7 24351635 missense probably damaging 0.96
R8704:Lypd5 UTSW 7 24351557 missense possibly damaging 0.62
R8725:Lypd5 UTSW 7 24353676 missense probably damaging 1.00
R8727:Lypd5 UTSW 7 24353676 missense probably damaging 1.00
X0057:Lypd5 UTSW 7 24349221 utr 5 prime probably benign
Z1177:Lypd5 UTSW 7 24352613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAAAGGATAAGCAGCCC -3'
(R):5'- GCTCACCTTGGCTCAGGT -3'

Sequencing Primer
(F):5'- CTGTGAACACTGCATGCATG -3'
(R):5'- ACCTTGGCTCAGGTTGGGG -3'
Posted On2016-07-06