Mutagenetix > Incidental Mutations

Incidental Mutation 'R0453:Pik3c2b'

39735

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

038653-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.392) question?

Stock #

R0453 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 133077396 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 545 (V545E)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: V545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: V545E

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124934

Meta Mutation Damage Score

0.6968

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.6%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,753,668	Y715C	probably damaging	Het
Acad10	T	A	5: 121,627,382	K843*	probably null	Het
Adam26b	T	C	8: 43,520,350	I538M	probably benign	Het
Adamtsl1	T	C	4: 86,232,615	Y337H	probably damaging	Het
Ak7	T	C	12: 105,716,048	M156T	probably damaging	Het
Aldh3a1	A	G	11: 61,215,512	M238V	probably benign	Het
Asic4	T	A	1: 75,473,511		probably benign	Het
AW551984	A	G	9: 39,600,641	S25P	probably damaging	Het
Bbs7	T	A	3: 36,607,669	Y127F	possibly damaging	Het
BC049730	T	A	7: 24,714,287	S243T	probably benign	Het
Bco1	G	A	8: 117,108,777	E156K	possibly damaging	Het
Becn1	T	C	11: 101,290,449	D342G	probably damaging	Het
Birc6	T	A	17: 74,649,754	I3575N	probably damaging	Het
Cc2d2a	A	T	5: 43,703,294	M522L	probably benign	Het
Cerkl	A	G	2: 79,342,451	F293L	probably benign	Het
Chil3	T	G	3: 106,148,905	N311T	probably benign	Het
Cpeb2	T	A	5: 43,285,713		probably benign	Het
Cpxm2	A	G	7: 132,128,405	S162P	probably damaging	Het
Cracr2b	A	C	7: 141,464,263	E136A	probably damaging	Het
Cyp2a4	T	A	7: 26,312,833	M347K	probably benign	Het
Dicer1	C	A	12: 104,702,630	R1264S	probably benign	Het
Dlgap1	T	A	17: 70,761,346	N609K	probably benign	Het
Dnhd1	A	G	7: 105,674,444	T641A	probably benign	Het
Egfl8	T	C	17: 34,614,882	Y74C	probably damaging	Het
Esyt1	A	G	10: 128,512,209	S901P	probably benign	Het
Fam83e	A	T	7: 45,723,948	D246V	probably damaging	Het
Galnt2	T	C	8: 124,338,584		probably benign	Het
Hdc	A	G	2: 126,594,951		probably benign	Het
Herc1	A	C	9: 66,399,772	Q958P	probably benign	Het
Iqcg	T	A	16: 33,049,843		probably benign	Het
Iqub	A	T	6: 24,450,830	F590Y	probably damaging	Het
Jak2	T	C	19: 29,311,838	I1130T	probably benign	Het
Kbtbd11	G	A	8: 15,027,499	A33T	probably benign	Het
Kcnip4	A	G	5: 48,509,712	L37P	probably damaging	Het
Klk6	A	G	7: 43,828,539	N112D	probably damaging	Het
Kmt2c	G	A	5: 25,354,747	T1011I	probably damaging	Het
Knl1	A	T	2: 119,068,388	K190M	probably damaging	Het
Lama3	T	A	18: 12,465,478	S981T	possibly damaging	Het
Lrrc18	T	C	14: 33,008,651	L49P	probably damaging	Het
Lrrc31	T	C	3: 30,687,525	E245G	probably damaging	Het
Macf1	T	C	4: 123,444,944	I2456M	probably benign	Het
Mcm6	T	A	1: 128,333,555	T771S	probably benign	Het
Met	A	C	6: 17,534,198	Y680S	possibly damaging	Het
Mixl1	T	A	1: 180,696,646	T123S	probably damaging	Het
Myh8	A	T	11: 67,292,905	I787F	probably benign	Het
Myocd	A	G	11: 65,196,225	F292S	probably damaging	Het
Neb	T	C	2: 52,313,890		probably null	Het
Nfe2l1	A	G	11: 96,827,368	S114P	probably damaging	Het
Nrxn2	T	C	19: 6,491,521	S986P	probably damaging	Het
Olfr1246	A	T	2: 89,590,751	Y121*	probably null	Het
Olfr1453	T	G	19: 13,027,931	T133P	probably damaging	Het
Olfr25	A	T	9: 38,330,171	T195S	probably benign	Het
Olfr745	T	C	14: 50,643,004	V241A	possibly damaging	Het
Olfr767	A	G	10: 129,079,771	F64S	probably damaging	Het
Olfr920	G	A	9: 38,756,129	G147D	probably damaging	Het
Oprl1	T	C	2: 181,718,734		probably null	Het
Panx2	T	A	15: 89,068,407	I359N	probably damaging	Het
Piwil4	T	C	9: 14,727,452	N259S	probably benign	Het
Plcxd2	A	T	16: 45,980,556	F102I	probably damaging	Het
Pld5	A	T	1: 176,089,956	M75K	possibly damaging	Het
Pmp22	T	A	11: 63,151,103		probably benign	Het
Polr2a	A	G	11: 69,741,019	S1074P	possibly damaging	Het
Pop1	T	A	15: 34,526,206	V649E	possibly damaging	Het
Prc1	A	G	7: 80,313,102	N548S	probably damaging	Het
Prss51	T	C	14: 64,097,139	L202P	probably damaging	Het
Rhpn1	T	C	15: 75,713,579	S576P	possibly damaging	Het
Rictor	A	G	15: 6,708,642	D20G	probably benign	Het
Rpl13a-ps1	A	T	19: 50,030,206	L177*	probably null	Het
Rpl23a-ps1	T	G	1: 45,981,927		noncoding transcript	Het
Saa2	A	G	7: 46,753,478	D51G	probably damaging	Het
Sec31a	A	T	5: 100,404,118		probably benign	Het
Secisbp2	G	A	13: 51,683,325	E841K	possibly damaging	Het
Serinc1	A	G	10: 57,517,210	Y437H	probably damaging	Het
Slc39a12	A	T	2: 14,435,681	H481L	probably benign	Het
Suz12	T	A	11: 80,030,033	N586K	probably damaging	Het
Synm	T	C	7: 67,736,882	Y344C	possibly damaging	Het
Tas2r104	A	G	6: 131,685,341	V135A	probably benign	Het
Tdrd9	T	C	12: 112,068,239	S1371P	probably benign	Het
Tg	T	A	15: 66,828,533	D893E	probably benign	Het
Thoc5	C	A	11: 4,918,217	D423E	possibly damaging	Het
Trim11	G	A	11: 58,990,535	R418H	probably damaging	Het
Trim52	T	G	14: 106,106,965	V19G	probably damaging	Het
Tuba4a	C	A	1: 75,215,858	V371L	probably damaging	Het
Ugt8a	A	G	3: 125,914,957	V168A	probably benign	Het
Ulk1	C	T	5: 110,791,085	G496R	probably damaging	Het
Usp40	A	G	1: 87,946,598	*1236Q	probably null	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r24	A	G	6: 123,780,391		probably null	Het
Vmn2r53	A	G	7: 12,582,411	Y494H	probably damaging	Het
Vmn2r65	T	A	7: 84,946,234	D414V	probably benign	Het
Wdr26	A	T	1: 181,182,879	L519*	probably null	Het
Wnk1	A	G	6: 119,963,151	V173A	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp318	T	C	17: 46,396,708	S231P	probably damaging	Het
Zfp398	T	C	6: 47,865,848	V146A	probably benign	Het
Zfp410	T	C	12: 84,331,712	M270T	probably damaging	Het
Zfp445	A	T	9: 122,853,513	H454Q	possibly damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7914:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7994:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- AGCGTGGTTCCTGCAATTCCTC -3'
(R):5'- AAAGCCTTTCTGGCCTTGGCTC -3'

Sequencing Primer
(F):5'- TCCTCCTTAGAGTCATTAACACAG -3'
(R):5'- gcctctgcctcccaaattc -3'

Posted On

2013-05-23