Incidental Mutation 'R0453:Pik3c2b'
ID39735
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
SynonymsC330011J12Rik, PI3K-C2beta
MMRRC Submission 038653-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.346) question?
Stock #R0453 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location133045667-133108687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133077396 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 545 (V545E)
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
Predicted Effect probably damaging
Transcript: ENSMUST00000077730
AA Change: V545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: V545E

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Meta Mutation Damage Score 0.6968 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.6%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,753,668 Y715C probably damaging Het
Acad10 T A 5: 121,627,382 K843* probably null Het
Adam26b T C 8: 43,520,350 I538M probably benign Het
Adamtsl1 T C 4: 86,232,615 Y337H probably damaging Het
Ak7 T C 12: 105,716,048 M156T probably damaging Het
Aldh3a1 A G 11: 61,215,512 M238V probably benign Het
Asic4 T A 1: 75,473,511 probably benign Het
AW551984 A G 9: 39,600,641 S25P probably damaging Het
Bbs7 T A 3: 36,607,669 Y127F possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bco1 G A 8: 117,108,777 E156K possibly damaging Het
Becn1 T C 11: 101,290,449 D342G probably damaging Het
Birc6 T A 17: 74,649,754 I3575N probably damaging Het
Cc2d2a A T 5: 43,703,294 M522L probably benign Het
Cerkl A G 2: 79,342,451 F293L probably benign Het
Chil3 T G 3: 106,148,905 N311T probably benign Het
Cpeb2 T A 5: 43,285,713 probably benign Het
Cpxm2 A G 7: 132,128,405 S162P probably damaging Het
Cracr2b A C 7: 141,464,263 E136A probably damaging Het
Cyp2a4 T A 7: 26,312,833 M347K probably benign Het
Dicer1 C A 12: 104,702,630 R1264S probably benign Het
Dlgap1 T A 17: 70,761,346 N609K probably benign Het
Dnhd1 A G 7: 105,674,444 T641A probably benign Het
Egfl8 T C 17: 34,614,882 Y74C probably damaging Het
Esyt1 A G 10: 128,512,209 S901P probably benign Het
Fam83e A T 7: 45,723,948 D246V probably damaging Het
Galnt2 T C 8: 124,338,584 probably benign Het
Hdc A G 2: 126,594,951 probably benign Het
Herc1 A C 9: 66,399,772 Q958P probably benign Het
Iqcg T A 16: 33,049,843 probably benign Het
Iqub A T 6: 24,450,830 F590Y probably damaging Het
Jak2 T C 19: 29,311,838 I1130T probably benign Het
Kbtbd11 G A 8: 15,027,499 A33T probably benign Het
Kcnip4 A G 5: 48,509,712 L37P probably damaging Het
Klk6 A G 7: 43,828,539 N112D probably damaging Het
Kmt2c G A 5: 25,354,747 T1011I probably damaging Het
Knl1 A T 2: 119,068,388 K190M probably damaging Het
Lama3 T A 18: 12,465,478 S981T possibly damaging Het
Lrrc18 T C 14: 33,008,651 L49P probably damaging Het
Lrrc31 T C 3: 30,687,525 E245G probably damaging Het
Macf1 T C 4: 123,444,944 I2456M probably benign Het
Mcm6 T A 1: 128,333,555 T771S probably benign Het
Met A C 6: 17,534,198 Y680S possibly damaging Het
Mixl1 T A 1: 180,696,646 T123S probably damaging Het
Myh8 A T 11: 67,292,905 I787F probably benign Het
Myocd A G 11: 65,196,225 F292S probably damaging Het
Neb T C 2: 52,313,890 probably null Het
Nfe2l1 A G 11: 96,827,368 S114P probably damaging Het
Nrxn2 T C 19: 6,491,521 S986P probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1453 T G 19: 13,027,931 T133P probably damaging Het
Olfr25 A T 9: 38,330,171 T195S probably benign Het
Olfr745 T C 14: 50,643,004 V241A possibly damaging Het
Olfr767 A G 10: 129,079,771 F64S probably damaging Het
Olfr920 G A 9: 38,756,129 G147D probably damaging Het
Oprl1 T C 2: 181,718,734 probably null Het
Panx2 T A 15: 89,068,407 I359N probably damaging Het
Piwil4 T C 9: 14,727,452 N259S probably benign Het
Plcxd2 A T 16: 45,980,556 F102I probably damaging Het
Pld5 A T 1: 176,089,956 M75K possibly damaging Het
Pmp22 T A 11: 63,151,103 probably benign Het
Polr2a A G 11: 69,741,019 S1074P possibly damaging Het
Pop1 T A 15: 34,526,206 V649E possibly damaging Het
Prc1 A G 7: 80,313,102 N548S probably damaging Het
Prss51 T C 14: 64,097,139 L202P probably damaging Het
Rhpn1 T C 15: 75,713,579 S576P possibly damaging Het
Rictor A G 15: 6,708,642 D20G probably benign Het
Rpl13a-ps1 A T 19: 50,030,206 L177* probably null Het
Rpl23a-ps1 T G 1: 45,981,927 noncoding transcript Het
Saa2 A G 7: 46,753,478 D51G probably damaging Het
Sec31a A T 5: 100,404,118 probably benign Het
Secisbp2 G A 13: 51,683,325 E841K possibly damaging Het
Serinc1 A G 10: 57,517,210 Y437H probably damaging Het
Slc39a12 A T 2: 14,435,681 H481L probably benign Het
Suz12 T A 11: 80,030,033 N586K probably damaging Het
Synm T C 7: 67,736,882 Y344C possibly damaging Het
Tas2r104 A G 6: 131,685,341 V135A probably benign Het
Tdrd9 T C 12: 112,068,239 S1371P probably benign Het
Tg T A 15: 66,828,533 D893E probably benign Het
Thoc5 C A 11: 4,918,217 D423E possibly damaging Het
Trim11 G A 11: 58,990,535 R418H probably damaging Het
Trim52 T G 14: 106,106,965 V19G probably damaging Het
Tuba4a C A 1: 75,215,858 V371L probably damaging Het
Ugt8a A G 3: 125,914,957 V168A probably benign Het
Ulk1 C T 5: 110,791,085 G496R probably damaging Het
Usp40 A G 1: 87,946,598 *1236Q probably null Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r24 A G 6: 123,780,391 probably null Het
Vmn2r53 A G 7: 12,582,411 Y494H probably damaging Het
Vmn2r65 T A 7: 84,946,234 D414V probably benign Het
Wdr26 A T 1: 181,182,879 L519* probably null Het
Wnk1 A G 6: 119,963,151 V173A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp318 T C 17: 46,396,708 S231P probably damaging Het
Zfp398 T C 6: 47,865,848 V146A probably benign Het
Zfp410 T C 12: 84,331,712 M270T probably damaging Het
Zfp445 A T 9: 122,853,513 H454Q possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133091618 missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133094805 missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 133071631 nonsense probably null
IGL01367:Pik3c2b APN 1 133105988 missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133094791 missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133077318 splice site probably benign
IGL02728:Pik3c2b APN 1 133092327 missense probably benign 0.09
IGL02992:Pik3c2b APN 1 133066980 nonsense probably null
IGL03121:Pik3c2b APN 1 133079745 missense probably benign 0.00
R0518:Pik3c2b UTSW 1 133105992 missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133100831 missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 133071200 missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133090034 missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133094826 missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1729:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1730:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1739:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1762:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1783:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1784:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1785:Pik3c2b UTSW 1 133066627 missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133101370 missense probably benign 0.00
R1897:Pik3c2b UTSW 1 133066916 missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 133066544 missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133099611 missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133103428 missense probably benign
R2294:Pik3c2b UTSW 1 133066775 missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133103413 missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 133067049 missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133099626 nonsense probably null
R4948:Pik3c2b UTSW 1 133099715 critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133105081 missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 133070408 missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133099702 missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133103836 missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133074627 splice site probably null
R5980:Pik3c2b UTSW 1 133088308 missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133090713 missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133074627 splice site probably null
R6223:Pik3c2b UTSW 1 133070357 missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 133066711 missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133075821 missense probably benign
R6954:Pik3c2b UTSW 1 133066303 missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133102372 missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133105974 missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133090234 missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133106112 missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 133066465 missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133079774 missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133094734 missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133090202 missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133090706 missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133079841 critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133085611 missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133102305 missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 133071242 missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133090061 critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133100904 missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133103849 missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133075809 critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133090246 missense probably damaging 0.97
U15987:Pik3c2b UTSW 1 133074627 splice site probably null
X0060:Pik3c2b UTSW 1 133084936 missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133066553 missense probably damaging 1.00
Z1176:Pik3c2b UTSW 1 133099686 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGTGGTTCCTGCAATTCCTC -3'
(R):5'- AAAGCCTTTCTGGCCTTGGCTC -3'

Sequencing Primer
(F):5'- TCCTCCTTAGAGTCATTAACACAG -3'
(R):5'- gcctctgcctcccaaattc -3'
Posted On2013-05-23