Mutagenetix > Incidental Mutations

Incidental Mutation 'R5167:Dscaml1'

397354

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

042747-MU

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R5167 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45717432 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1095 (Y1095H)

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034592
AA Change: Y1095H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: Y1095H

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000216685
AA Change: Y124H

Meta Mutation Damage Score

0.1235

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Calm3	T	C	7: 16,917,701	D21G	probably damaging	Het
Cldn23	C	T	8: 35,826,320	V5M	possibly damaging	Het
D630003M21Rik	A	G	2: 158,205,745	S735P	probably damaging	Het
Esr2	T	C	12: 76,123,274	T427A	probably benign	Het
Fbxo28	T	C	1: 182,317,993	I177V	possibly damaging	Het
Fubp1	T	C	3: 152,221,352	L372P	possibly damaging	Het
Glis1	G	A	4: 107,634,694	G585E	probably damaging	Het
Gm7258	T	C	7: 128,596,067		noncoding transcript	Het
Hecw1	C	T	13: 14,285,657	R613Q	probably damaging	Het
Kif13b	T	C	14: 64,772,935	S1228P	probably damaging	Het
Knl1	A	G	2: 119,070,031	I738V	probably damaging	Het
Lig1	T	A	7: 13,311,058	V892D	probably damaging	Het
Lvrn	T	A	18: 46,880,747	Y499N	probably damaging	Het
Ly9	C	A	1: 171,605,205	W80L	probably damaging	Het
Lypd5	T	C	7: 24,352,464	V68A	possibly damaging	Het
Ngdn	C	T	14: 55,022,199	Q236*	probably null	Het
Nudt7	C	A	8: 114,151,827	C154*	probably null	Het
Olfr116	C	A	17: 37,623,751	E295*	probably null	Het
Olfr1307	A	T	2: 111,945,102	M118K	probably damaging	Het
Olfr1472	T	A	19: 13,454,377	I47F	probably damaging	Het
Paxbp1	A	G	16: 91,022,667		probably null	Het
Pcnt	G	T	10: 76,420,424	Q661K	probably damaging	Het
Plekha1	G	A	7: 130,885,449		probably null	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Rac3	A	G	11: 120,722,595	D58G	probably null	Het
Rgl2	C	T	17: 33,935,974	R203*	probably null	Het
Rnf219	A	G	14: 104,478,787	S717P	probably damaging	Het
Ryr1	T	C	7: 29,067,693	D2948G	probably damaging	Het
Serpina12	A	T	12: 104,037,920	L151Q	probably damaging	Het
Sf3a1	T	C	11: 4,177,456	V594A	possibly damaging	Het
Spdl1	G	T	11: 34,813,360	H549N	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Zfp352	A	G	4: 90,224,216	T198A	possibly damaging	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R4924:Dscaml1	UTSW	9	45745189	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R5977:Dscaml1	UTSW	9	45721298	missense	probably benign	0.19
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6582:Dscaml1	UTSW	9	45752806	missense	probably benign	0.00
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7286:Dscaml1	UTSW	9	45742746	critical splice donor site	probably null
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7439:Dscaml1	UTSW	9	45710326	missense	possibly damaging	0.94
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCACAGAGTAGTGATGTGCTC -3'
(R):5'- CCTACGGGATCAATGTAGGC -3'

Sequencing Primer
(F):5'- GTGCTCTTGGCTCTAAGAACAAAGAC -3'
(R):5'- TGGGTCTGCCTGGAAGAAC -3'

Posted On

2016-07-06