Mutagenetix > Incidental Mutations

Incidental Mutation 'R5167:Sf3a1'

397356

Institutional Source

Beutler Lab

Gene Symbol

Sf3a1

Ensembl Gene

ENSMUSG00000002129

Gene Name

splicing factor 3a, subunit 1

Synonyms

MMRRC Submission

042747-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5167 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4160350-4182541 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4177456 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 594 (V594A)

Ref Sequence

ENSEMBL: ENSMUSP00000002198 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002198]

PDB Structure

Solution structure of Ubiquitin-like domain in SF3a120 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002198
AA Change: V594A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000002198
Gene: ENSMUSG00000002129
AA Change: V594A

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
SWAP	50	103	4.99e-30	SMART
low complexity region	118	138	N/A	INTRINSIC
SWAP	164	217	3.22e-24	SMART
Pfam:PRP21_like_P	227	469	7e-81	PFAM
low complexity region	552	560	N/A	INTRINSIC
low complexity region	574	589	N/A	INTRINSIC
low complexity region	624	673	N/A	INTRINSIC
UBQ	713	784	6.52e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133095

Meta Mutation Damage Score

0.1037

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (38/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Calm3	T	C	7: 16,917,701	D21G	probably damaging	Het
Cldn23	C	T	8: 35,826,320	V5M	possibly damaging	Het
D630003M21Rik	A	G	2: 158,205,745	S735P	probably damaging	Het
Dscaml1	T	C	9: 45,717,432	Y1095H	probably damaging	Het
Esr2	T	C	12: 76,123,274	T427A	probably benign	Het
Fbxo28	T	C	1: 182,317,993	I177V	possibly damaging	Het
Fubp1	T	C	3: 152,221,352	L372P	possibly damaging	Het
Glis1	G	A	4: 107,634,694	G585E	probably damaging	Het
Gm7258	T	C	7: 128,596,067		noncoding transcript	Het
Hecw1	C	T	13: 14,285,657	R613Q	probably damaging	Het
Kif13b	T	C	14: 64,772,935	S1228P	probably damaging	Het
Knl1	A	G	2: 119,070,031	I738V	probably damaging	Het
Lig1	T	A	7: 13,311,058	V892D	probably damaging	Het
Lvrn	T	A	18: 46,880,747	Y499N	probably damaging	Het
Ly9	C	A	1: 171,605,205	W80L	probably damaging	Het
Lypd5	T	C	7: 24,352,464	V68A	possibly damaging	Het
Ngdn	C	T	14: 55,022,199	Q236*	probably null	Het
Nudt7	C	A	8: 114,151,827	C154*	probably null	Het
Olfr116	C	A	17: 37,623,751	E295*	probably null	Het
Olfr1307	A	T	2: 111,945,102	M118K	probably damaging	Het
Olfr1472	T	A	19: 13,454,377	I47F	probably damaging	Het
Paxbp1	A	G	16: 91,022,667		probably null	Het
Pcnt	G	T	10: 76,420,424	Q661K	probably damaging	Het
Plekha1	G	A	7: 130,885,449		probably null	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Rac3	A	G	11: 120,722,595	D58G	probably null	Het
Rgl2	C	T	17: 33,935,974	R203*	probably null	Het
Rnf219	A	G	14: 104,478,787	S717P	probably damaging	Het
Ryr1	T	C	7: 29,067,693	D2948G	probably damaging	Het
Serpina12	A	T	12: 104,037,920	L151Q	probably damaging	Het
Spdl1	G	T	11: 34,813,360	H549N	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Zfp352	A	G	4: 90,224,216	T198A	possibly damaging	Het

Other mutations in Sf3a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01899:Sf3a1	APN	11	4171063	missense	probably damaging	1.00
IGL02883:Sf3a1	APN	11	4179192	missense	probably damaging	1.00
IGL03061:Sf3a1	APN	11	4175493	missense	probably damaging	1.00
R1469:Sf3a1	UTSW	11	4175380	splice site	probably benign
R1561:Sf3a1	UTSW	11	4179217	missense	probably benign
R1905:Sf3a1	UTSW	11	4176678	missense	probably benign	0.01
R1993:Sf3a1	UTSW	11	4179177	missense	possibly damaging	0.51
R2264:Sf3a1	UTSW	11	4177443	missense	probably benign	0.28
R3935:Sf3a1	UTSW	11	4180024	splice site	probably null
R3936:Sf3a1	UTSW	11	4180024	splice site	probably null
R4065:Sf3a1	UTSW	11	4167824	missense	probably damaging	1.00
R4067:Sf3a1	UTSW	11	4167824	missense	probably damaging	1.00
R4245:Sf3a1	UTSW	11	4167774	missense	probably damaging	1.00
R5434:Sf3a1	UTSW	11	4174041	missense	probably damaging	1.00
R7471:Sf3a1	UTSW	11	4167724	missense	possibly damaging	0.94
R7506:Sf3a1	UTSW	11	4177561	missense	probably benign	0.02
R7943:Sf3a1	UTSW	11	4166537	missense	possibly damaging	0.46
R8039:Sf3a1	UTSW	11	4167787	missense	probably damaging	1.00
R8074:Sf3a1	UTSW	11	4175435	nonsense	probably null
R8299:Sf3a1	UTSW	11	4179420	missense	possibly damaging	0.88
R8500:Sf3a1	UTSW	11	4175039	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TCATTGGCCTGAGGTGAAAC -3'
(R):5'- ACCACAGCTTTATGGACTAACC -3'

Sequencing Primer
(F):5'- CCTGAGGTGAAACTTGAGTCTCAG -3'
(R):5'- CAGCTTTATGGACTAACCCATGAG -3'

Posted On

2016-07-06