Mutagenetix > Incidental Mutation

Incidental Mutation 'R5167:Serpina12'

397361

Institutional Source

Beutler Lab

Gene Symbol

Serpina12

Ensembl Gene

ENSMUSG00000041567

Gene Name

serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12

Synonyms

vaspin

MMRRC Submission

042747-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5167 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104028769-104044443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104037920 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 151 (L151Q)

Ref Sequence

ENSEMBL: ENSMUSP00000045572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043915]

AlphaFold

Q7TMF5

Predicted Effect

probably damaging
Transcript: ENSMUST00000043915
AA Change: L151Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045572
Gene: ENSMUSG00000041567
AA Change: L151Q

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SERPIN	57	411	1.02e-139	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (38/39)

MGI Phenotype

PHENOTYPE: Mice hmomozygous for a knock-out allele exhibit increased body weight, epididymal fat pad weight, liver weight, fat cell size, serum total and small density LDL cholesterol, serum leptin, liver triglyceride and insulin resistance when fed a high fat, high sucrose diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,812,656	Y113N	probably damaging	Het
Bcan	G	T	3: 87,994,207	S396Y	probably damaging	Het
Calm3	T	C	7: 16,917,701	D21G	probably damaging	Het
Cldn23	C	T	8: 35,826,320	V5M	possibly damaging	Het
D630003M21Rik	A	G	2: 158,205,745	S735P	probably damaging	Het
Dscaml1	T	C	9: 45,717,432	Y1095H	probably damaging	Het
Esr2	T	C	12: 76,123,274	T427A	probably benign	Het
Fbxo28	T	C	1: 182,317,993	I177V	possibly damaging	Het
Fubp1	T	C	3: 152,221,352	L372P	possibly damaging	Het
Glis1	G	A	4: 107,634,694	G585E	probably damaging	Het
Gm7258	T	C	7: 128,596,067		noncoding transcript	Het
Hecw1	C	T	13: 14,285,657	R613Q	probably damaging	Het
Kif13b	T	C	14: 64,772,935	S1228P	probably damaging	Het
Knl1	A	G	2: 119,070,031	I738V	probably damaging	Het
Lig1	T	A	7: 13,311,058	V892D	probably damaging	Het
Lvrn	T	A	18: 46,880,747	Y499N	probably damaging	Het
Ly9	C	A	1: 171,605,205	W80L	probably damaging	Het
Lypd5	T	C	7: 24,352,464	V68A	possibly damaging	Het
Ngdn	C	T	14: 55,022,199	Q236*	probably null	Het
Nudt7	C	A	8: 114,151,827	C154*	probably null	Het
Olfr116	C	A	17: 37,623,751	E295*	probably null	Het
Olfr1307	A	T	2: 111,945,102	M118K	probably damaging	Het
Olfr1472	T	A	19: 13,454,377	I47F	probably damaging	Het
Paxbp1	A	G	16: 91,022,667		probably null	Het
Pcnt	G	T	10: 76,420,424	Q661K	probably damaging	Het
Plekha1	G	A	7: 130,885,449		probably null	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Rac3	A	G	11: 120,722,595	D58G	probably null	Het
Rgl2	C	T	17: 33,935,974	R203*	probably null	Het
Rnf219	A	G	14: 104,478,787	S717P	probably damaging	Het
Ryr1	T	C	7: 29,067,693	D2948G	probably damaging	Het
Sf3a1	T	C	11: 4,177,456	V594A	possibly damaging	Het
Spdl1	G	T	11: 34,813,360	H549N	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Zfp352	A	G	4: 90,224,216	T198A	possibly damaging	Het

Other mutations in Serpina12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Serpina12	APN	12	104031114	missense	probably benign	0.01
IGL00976:Serpina12	APN	12	104032528	missense	probably damaging	1.00
IGL01592:Serpina12	APN	12	104038122	missense	probably damaging	1.00
IGL02355:Serpina12	APN	12	104037881	missense	probably benign	0.00
IGL02362:Serpina12	APN	12	104037881	missense	probably benign	0.00
IGL02648:Serpina12	APN	12	104038008	missense	probably benign	0.02
IGL03011:Serpina12	APN	12	104031138	missense	possibly damaging	0.86
IGL03156:Serpina12	APN	12	104037899	missense	probably damaging	1.00
sabina	UTSW	12	104037920	missense	probably damaging	1.00
PIT4305001:Serpina12	UTSW	12	104035717	missense	probably damaging	1.00
R0038:Serpina12	UTSW	12	104037957	missense	probably damaging	1.00
R0038:Serpina12	UTSW	12	104037957	missense	probably damaging	1.00
R0448:Serpina12	UTSW	12	104038095	missense	probably benign	0.20
R0465:Serpina12	UTSW	12	104037845	missense	probably benign	0.04
R0480:Serpina12	UTSW	12	104035701	missense	probably damaging	1.00
R0498:Serpina12	UTSW	12	104035789	missense	probably damaging	1.00
R0503:Serpina12	UTSW	12	104031159	missense	probably damaging	0.97
R0581:Serpina12	UTSW	12	104031140	missense	probably damaging	0.97
R1393:Serpina12	UTSW	12	104037750	missense	possibly damaging	0.73
R1847:Serpina12	UTSW	12	104032510	missense	probably damaging	1.00
R1956:Serpina12	UTSW	12	104035789	missense	probably damaging	1.00
R3125:Serpina12	UTSW	12	104037983	missense	probably benign
R4093:Serpina12	UTSW	12	104037924	missense	probably damaging	1.00
R4584:Serpina12	UTSW	12	104038352	missense	unknown
R4897:Serpina12	UTSW	12	104037797	missense	possibly damaging	0.60
R5117:Serpina12	UTSW	12	104037750	missense	possibly damaging	0.73
R5344:Serpina12	UTSW	12	104035548	splice site	probably null
R5720:Serpina12	UTSW	12	104038304	missense	probably benign	0.05
R6011:Serpina12	UTSW	12	104035734	missense	probably damaging	1.00
R6027:Serpina12	UTSW	12	104031077	missense	probably benign	0.01
R6170:Serpina12	UTSW	12	104038241	missense	probably benign	0.03
R7538:Serpina12	UTSW	12	104038328	missense	unknown
R7899:Serpina12	UTSW	12	104038265	missense	probably benign	0.01
R9649:Serpina12	UTSW	12	104038058	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCTAGCCTTACCTCGAAAG -3'
(R):5'- GCTTCAAGCTACTGCAGAGG -3'

Sequencing Primer
(F):5'- AATCATCACGGTGCCTG -3'
(R):5'- AAGCTACTGCAGAGGCTGGC -3'

Posted On

2016-07-06