Incidental Mutation 'R5167:Olfr116'
ID397368
Institutional Source Beutler Lab
Gene Symbol Olfr116
Ensembl Gene ENSMUSG00000061336
Gene Nameolfactory receptor 116
SynonymsMOR218-2, GA_x6K02T2PSCP-2084102-2083137
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37620577-37627199 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 37623751 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 295 (E295*)
Ref Sequence ENSEMBL: ENSMUSP00000150977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072265] [ENSMUST00000216128] [ENSMUST00000223366]
Predicted Effect probably null
Transcript: ENSMUST00000072265
AA Change: E295*
SMART Domains Protein: ENSMUSP00000072115
Gene: ENSMUSG00000061336
AA Change: E295*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 6.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216128
AA Change: E295*
Predicted Effect probably benign
Transcript: ENSMUST00000223366
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Lvrn T A 18: 46,880,747 Y499N probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Olfr116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Olfr116 APN 17 37624576 missense possibly damaging 0.86
IGL02639:Olfr116 APN 17 37623987 missense probably benign 0.01
IGL02663:Olfr116 APN 17 37624044 missense probably benign 0.37
R0049:Olfr116 UTSW 17 37624133 missense probably benign 0.02
R1260:Olfr116 UTSW 17 37623703 missense probably benign 0.00
R1531:Olfr116 UTSW 17 37624352 nonsense probably null
R3236:Olfr116 UTSW 17 37624236 missense possibly damaging 0.65
R4083:Olfr116 UTSW 17 37624425 missense probably damaging 1.00
R4308:Olfr116 UTSW 17 37623736 missense possibly damaging 0.46
R4887:Olfr116 UTSW 17 37623891 missense probably damaging 0.99
R5323:Olfr116 UTSW 17 37624155 missense probably benign 0.22
R5496:Olfr116 UTSW 17 37624578 missense probably benign 0.01
R5530:Olfr116 UTSW 17 37623807 missense possibly damaging 0.72
R5643:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5644:Olfr116 UTSW 17 37624432 missense probably benign 0.00
R5798:Olfr116 UTSW 17 37623990 missense probably benign 0.01
R6020:Olfr116 UTSW 17 37623967 missense possibly damaging 0.94
R7058:Olfr116 UTSW 17 37623706 missense probably benign 0.00
R7453:Olfr116 UTSW 17 37624385 missense probably benign 0.00
R7474:Olfr116 UTSW 17 37624386 missense probably benign 0.30
R7565:Olfr116 UTSW 17 37624501 missense probably damaging 0.99
R7646:Olfr116 UTSW 17 37624404 missense probably damaging 1.00
Z1088:Olfr116 UTSW 17 37624429 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCATTAGGATGTAAGTAGTGGATCTC -3'
(R):5'- AAGCAGGTCTAAGGTCTTCTCTAC -3'

Sequencing Primer
(F):5'- GCAAGGACAATTGTTACATAATGTAG -3'
(R):5'- AGGTCTAAGGTCTTCTCTACTTGCC -3'
Posted On2016-07-06