Incidental Mutation 'R5167:Lvrn'
ID397370
Institutional Source Beutler Lab
Gene Symbol Lvrn
Ensembl Gene ENSMUSG00000024481
Gene Namelaeverin
Synonyms4833403I15Rik, Aqpep
MMRRC Submission 042747-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R5167 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46850039-46905446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46880747 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 499 (Y499N)
Ref Sequence ENSEMBL: ENSMUSP00000025358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025358]
Predicted Effect probably damaging
Transcript: ENSMUST00000025358
AA Change: Y499N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025358
Gene: ENSMUSG00000024481
AA Change: Y499N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Peptidase_M1 94 504 1.6e-110 PFAM
Pfam:ERAP1_C 645 968 2.5e-60 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,812,656 Y113N probably damaging Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Calm3 T C 7: 16,917,701 D21G probably damaging Het
Cldn23 C T 8: 35,826,320 V5M possibly damaging Het
D630003M21Rik A G 2: 158,205,745 S735P probably damaging Het
Dscaml1 T C 9: 45,717,432 Y1095H probably damaging Het
Esr2 T C 12: 76,123,274 T427A probably benign Het
Fbxo28 T C 1: 182,317,993 I177V possibly damaging Het
Fubp1 T C 3: 152,221,352 L372P possibly damaging Het
Glis1 G A 4: 107,634,694 G585E probably damaging Het
Gm7258 T C 7: 128,596,067 noncoding transcript Het
Hecw1 C T 13: 14,285,657 R613Q probably damaging Het
Kif13b T C 14: 64,772,935 S1228P probably damaging Het
Knl1 A G 2: 119,070,031 I738V probably damaging Het
Lig1 T A 7: 13,311,058 V892D probably damaging Het
Ly9 C A 1: 171,605,205 W80L probably damaging Het
Lypd5 T C 7: 24,352,464 V68A possibly damaging Het
Ngdn C T 14: 55,022,199 Q236* probably null Het
Nudt7 C A 8: 114,151,827 C154* probably null Het
Olfr116 C A 17: 37,623,751 E295* probably null Het
Olfr1307 A T 2: 111,945,102 M118K probably damaging Het
Olfr1472 T A 19: 13,454,377 I47F probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pcnt G T 10: 76,420,424 Q661K probably damaging Het
Plekha1 G A 7: 130,885,449 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Rac3 A G 11: 120,722,595 D58G probably null Het
Rgl2 C T 17: 33,935,974 R203* probably null Het
Rnf219 A G 14: 104,478,787 S717P probably damaging Het
Ryr1 T C 7: 29,067,693 D2948G probably damaging Het
Serpina12 A T 12: 104,037,920 L151Q probably damaging Het
Sf3a1 T C 11: 4,177,456 V594A possibly damaging Het
Spdl1 G T 11: 34,813,360 H549N possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Zfp352 A G 4: 90,224,216 T198A possibly damaging Het
Other mutations in Lvrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Lvrn APN 18 46864666 splice site probably benign
IGL01532:Lvrn APN 18 46900484 missense probably damaging 1.00
IGL02430:Lvrn APN 18 46894730 missense probably benign 0.03
IGL02573:Lvrn APN 18 46876949 missense probably damaging 0.98
IGL02592:Lvrn APN 18 46850591 missense probably damaging 1.00
IGL02754:Lvrn APN 18 46890904 nonsense probably null
IGL03089:Lvrn APN 18 46880709 missense probably damaging 0.99
IGL03209:Lvrn APN 18 46889498 missense probably benign 0.00
IGL03333:Lvrn APN 18 46864664 splice site probably benign
IGL03098:Lvrn UTSW 18 46881410 critical splice acceptor site probably null
R0319:Lvrn UTSW 18 46864753 missense probably damaging 1.00
R0391:Lvrn UTSW 18 46850466 missense probably benign 0.01
R0398:Lvrn UTSW 18 46880693 missense probably benign 0.06
R0432:Lvrn UTSW 18 46905299 missense possibly damaging 0.94
R0456:Lvrn UTSW 18 46864816 critical splice donor site probably null
R1458:Lvrn UTSW 18 46882385 splice site probably benign
R1612:Lvrn UTSW 18 46894703 missense probably damaging 0.99
R1935:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1936:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1959:Lvrn UTSW 18 46894717 missense probably damaging 1.00
R2000:Lvrn UTSW 18 46905307 missense probably benign 0.04
R2022:Lvrn UTSW 18 46866436 missense possibly damaging 0.81
R2106:Lvrn UTSW 18 46878289 missense probably damaging 1.00
R2197:Lvrn UTSW 18 46878342 missense probably benign 0.03
R2371:Lvrn UTSW 18 46878163 intron probably null
R4125:Lvrn UTSW 18 46876969 missense possibly damaging 0.53
R4606:Lvrn UTSW 18 46864765 missense possibly damaging 0.92
R4830:Lvrn UTSW 18 46905351 missense probably damaging 1.00
R4866:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46881412 missense probably damaging 1.00
R4924:Lvrn UTSW 18 46894725 missense probably damaging 1.00
R4948:Lvrn UTSW 18 46880736 missense probably damaging 1.00
R5527:Lvrn UTSW 18 46873803 missense probably damaging 1.00
R5581:Lvrn UTSW 18 46890865 missense probably benign 0.17
R5615:Lvrn UTSW 18 46850328 missense possibly damaging 0.55
R5859:Lvrn UTSW 18 46893749 missense probably damaging 1.00
R6149:Lvrn UTSW 18 46884432 missense probably benign 0.10
R6183:Lvrn UTSW 18 46850685 missense probably benign 0.14
R6378:Lvrn UTSW 18 46894957 missense probably benign 0.00
R6838:Lvrn UTSW 18 46890880 missense possibly damaging 0.88
R6993:Lvrn UTSW 18 46882298 missense probably benign 0.18
R7017:Lvrn UTSW 18 46850678 missense probably benign 0.00
R7168:Lvrn UTSW 18 46881322 missense probably benign 0.29
R7190:Lvrn UTSW 18 46900503 missense probably benign 0.02
R7315:Lvrn UTSW 18 46876984 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TAACCCTTGAAAGTTAATGTGGCTC -3'
(R):5'- TGGCTGAGTTGGTAAAGGAC -3'

Sequencing Primer
(F):5'- AGTTAATGTGGCTCAATCTTTTCC -3'
(R):5'- AGGACCCAATATCTAATATGACCAC -3'
Posted On2016-07-06