Incidental Mutation 'R5168:Tmem236'
ID397377
Institutional Source Beutler Lab
Gene Symbol Tmem236
Ensembl Gene ENSMUSG00000061531
Gene Nametransmembrane protein 236
SynonymsFam23a, 2010003H20Rik
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14174523-14221993 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 14192328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077517]
Predicted Effect probably null
Transcript: ENSMUST00000077517
SMART Domains Protein: ENSMUSP00000076722
Gene: ENSMUSG00000061531

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
low complexity region 119 143 N/A INTRINSIC
transmembrane domain 256 275 N/A INTRINSIC
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120155
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Tmem236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tmem236 APN 2 14219378 missense probably damaging 1.00
IGL01363:Tmem236 APN 2 14174630 missense probably damaging 1.00
IGL01980:Tmem236 APN 2 14218905 missense probably benign 0.16
IGL02749:Tmem236 APN 2 14219321 missense probably damaging 1.00
R0172:Tmem236 UTSW 2 14218883 missense probably benign 0.06
R1470:Tmem236 UTSW 2 14218921 missense probably benign 0.22
R1470:Tmem236 UTSW 2 14218921 missense probably benign 0.22
R1519:Tmem236 UTSW 2 14192280 missense probably benign 0.00
R1923:Tmem236 UTSW 2 14219306 missense probably damaging 1.00
R2147:Tmem236 UTSW 2 14219050 missense probably benign 0.03
R4226:Tmem236 UTSW 2 14174626 nonsense probably null
R4551:Tmem236 UTSW 2 14219153 missense probably benign 0.02
R4904:Tmem236 UTSW 2 14195992 missense probably benign
R5283:Tmem236 UTSW 2 14174833 missense probably benign 0.01
R5306:Tmem236 UTSW 2 14219164 nonsense probably null
R5334:Tmem236 UTSW 2 14219060 missense possibly damaging 0.85
R6516:Tmem236 UTSW 2 14195980 missense probably benign 0.00
R6604:Tmem236 UTSW 2 14174701 missense probably benign 0.03
R7689:Tmem236 UTSW 2 14192265 missense probably damaging 0.99
X0062:Tmem236 UTSW 2 14219278 missense probably damaging 1.00
Z1177:Tmem236 UTSW 2 14174727 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCATGCTCAAACATTTGG -3'
(R):5'- TGTGCAAACTATTTATCAGTGGGTG -3'

Sequencing Primer
(F):5'- GCAGTGAGCTTCTTAGAAAAAGC -3'
(R):5'- GTATCATATACACAAGCACAGAAGTG -3'
Posted On2016-07-06