Incidental Mutation 'R5168:Abca1'
ID397386
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53086070 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 478 (N478D)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: N478D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: N478D

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATCTTGCTCACCAGGCCTG -3'
(R):5'- CTCTTTACCATGACACTTGATGATCAC -3'

Sequencing Primer
(F):5'- GGATACAGCTGTACATGACACTGC -3'
(R):5'- GACACTTGATGATCACTGTTCGCATG -3'
Posted On2016-07-06