Incidental Mutation 'R5168:Ddx54'
ID397391
Institutional Source Beutler Lab
Gene Symbol Ddx54
Ensembl Gene ENSMUSG00000029599
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms2410015A15Rik, APR-5, DP97
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120612739-120628592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120617032 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000031598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598] [ENSMUST00000031599] [ENSMUST00000111884] [ENSMUST00000140554] [ENSMUST00000177800]
Predicted Effect probably benign
Transcript: ENSMUST00000031598
AA Change: E82G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599
AA Change: E82G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031599
SMART Domains Protein: ENSMUSP00000031599
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136070
Predicted Effect probably benign
Transcript: ENSMUST00000140554
Predicted Effect probably benign
Transcript: ENSMUST00000177800
SMART Domains Protein: ENSMUSP00000136946
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
Pfam:RITA 1 253 2.5e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202672
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Ddx54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ddx54 APN 5 120623810 critical splice donor site probably null
IGL01324:Ddx54 APN 5 120623638 missense probably benign 0.00
IGL01399:Ddx54 APN 5 120623903 nonsense probably null
IGL02052:Ddx54 APN 5 120625718 missense possibly damaging 0.93
IGL02095:Ddx54 APN 5 120623791 missense possibly damaging 0.81
IGL02370:Ddx54 APN 5 120619787 missense probably damaging 1.00
IGL02861:Ddx54 APN 5 120618130 splice site probably benign
R0521:Ddx54 UTSW 5 120626862 missense probably benign 0.00
R0556:Ddx54 UTSW 5 120619654 splice site probably benign
R0723:Ddx54 UTSW 5 120623638 missense probably benign 0.00
R2968:Ddx54 UTSW 5 120618629 missense probably damaging 1.00
R4622:Ddx54 UTSW 5 120626423 missense probably damaging 1.00
R4853:Ddx54 UTSW 5 120623629 missense probably benign 0.12
R5169:Ddx54 UTSW 5 120623263 missense probably damaging 1.00
R5424:Ddx54 UTSW 5 120619861 critical splice donor site probably null
R5489:Ddx54 UTSW 5 120624721 missense probably benign
R5956:Ddx54 UTSW 5 120626367 unclassified probably benign
R5999:Ddx54 UTSW 5 120623580 missense probably benign 0.00
R6220:Ddx54 UTSW 5 120620689 missense probably benign 0.09
R6413:Ddx54 UTSW 5 120627062 missense probably benign
R6477:Ddx54 UTSW 5 120621778 missense probably damaging 1.00
R6702:Ddx54 UTSW 5 120626503 missense possibly damaging 0.52
R6783:Ddx54 UTSW 5 120618714 nonsense probably null
R6865:Ddx54 UTSW 5 120621827 critical splice donor site probably null
R7258:Ddx54 UTSW 5 120620747 missense probably damaging 1.00
R7260:Ddx54 UTSW 5 120626920 missense probably benign 0.21
R7488:Ddx54 UTSW 5 120624724 missense probably benign
R7887:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
R7970:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGAACTAACCTGCGCCTC -3'
(R):5'- AAGACTGTCTGTACTGCCCC -3'

Sequencing Primer
(F):5'- CCCAGCCTGGTCCAAGG -3'
(R):5'- CAGGCCTAAGGTAGACAT -3'
Posted On2016-07-06