Incidental Mutation 'R5168:Katnal1'
ID397392
Institutional Source Beutler Lab
Gene Symbol Katnal1
Ensembl Gene ENSMUSG00000041298
Gene Namekatanin p60 subunit A-like 1
Synonyms
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location148871584-148929320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148921322 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 26 (M26T)
Ref Sequence ENSEMBL: ENSMUSP00000120502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047257] [ENSMUST00000110509] [ENSMUST00000147473] [ENSMUST00000149169]
Predicted Effect probably benign
Transcript: ENSMUST00000047257
AA Change: M26T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043210
Gene: ENSMUSG00000041298
AA Change: M26T

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-19 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
AAA 238 380 3.01e-20 SMART
Pfam:Vps4_C 437 486 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110508
Predicted Effect possibly damaging
Transcript: ENSMUST00000110509
AA Change: M26T

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106136
Gene: ENSMUSG00000041298
AA Change: M26T

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-20 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Blast:AAA 159 229 8e-7 BLAST
PDB:4L16|A 184 234 3e-8 PDB
SCOP:d1iqpa2 185 234 4e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147473
AA Change: M26T

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120502
Gene: ENSMUSG00000106892
AA Change: M26T

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 1e-20 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149169
AA Change: M26T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120707
Gene: ENSMUSG00000041298
AA Change: M26T

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 2e-21 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152360
Meta Mutation Damage Score 0.1954 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation display male infertility with decreased testis weight and premature exfoliation of spermatids from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Haus5 T C 7: 30,657,711 T432A possibly damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Katnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Katnal1 APN 5 148893797 splice site probably benign
IGL02369:Katnal1 APN 5 148878927 missense probably benign 0.04
R0001:Katnal1 UTSW 5 148921275 missense probably damaging 0.98
R0230:Katnal1 UTSW 5 148918650 missense possibly damaging 0.60
R0308:Katnal1 UTSW 5 148878924 missense possibly damaging 0.95
R0591:Katnal1 UTSW 5 148892516 missense probably damaging 1.00
R1220:Katnal1 UTSW 5 148894251 missense probably benign 0.00
R1448:Katnal1 UTSW 5 148904676 missense probably benign 0.37
R2163:Katnal1 UTSW 5 148888936 missense probably damaging 1.00
R4791:Katnal1 UTSW 5 148904650 missense probably damaging 1.00
R6182:Katnal1 UTSW 5 148904597 missense possibly damaging 0.83
R6542:Katnal1 UTSW 5 148876206 missense probably benign 0.01
R6836:Katnal1 UTSW 5 148894164 missense probably damaging 1.00
R7077:Katnal1 UTSW 5 148891737 missense probably benign 0.00
R7490:Katnal1 UTSW 5 148891682 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGTGAATCGTGAACTG -3'
(R):5'- CTGTTCAGACTCTCAAGGCAC -3'

Sequencing Primer
(F):5'- ATGGTCAAAAGCTCCGGC -3'
(R):5'- GTTCAGACTCTCAAGGCACATGTTAC -3'
Posted On2016-07-06