Mutagenetix > Incidental Mutations

Incidental Mutation 'R5168:Haus5'

397395

Institutional Source

Beutler Lab

Gene Symbol

Haus5

Ensembl Gene

ENSMUSG00000078762

Gene Name

HAUS augmin-like complex, subunit 5

Synonyms

2310022K01Rik

MMRRC Submission

042748-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R5168 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30653711-30664994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30657711 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 432 (T432A)

Ref Sequence

ENSEMBL: ENSMUSP00000019697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019697] [ENSMUST00000132862]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019697
AA Change: T432A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000019697
Gene: ENSMUSG00000078762
AA Change: T432A

Domain	Start	End	E-Value	Type
Pfam:HAUS5	7	617	9.8e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126511

Predicted Effect

probably benign
Transcript: ENSMUST00000132862
AA Change: T432A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000121739
Gene: ENSMUSG00000078762
AA Change: T432A

Domain	Start	End	E-Value	Type
Pfam:HAUS5	5	515	4.4e-182	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142741

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142823

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146232

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181529

Meta Mutation Damage Score

0.0633

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HAUS5 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]; Uehara et al., 2009 [PubMed 19369198]).[supplied by OMIM, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	T	C	4: 53,086,070	N478D	probably benign	Het
Acsl1	T	A	8: 46,513,266		probably benign	Het
Aox1	T	A	1: 58,049,402	C116S	probably damaging	Het
Bag6	T	C	17: 35,144,695	L785P	probably damaging	Het
Calcr	T	C	6: 3,708,610	N192S	probably benign	Het
Cntrl	T	A	2: 35,157,655	L1414H	probably damaging	Het
Cntrob	T	A	11: 69,299,990	I849F	possibly damaging	Het
Col6a3	C	T	1: 90,773,639	W2518*	probably null	Het
Cxcl15	T	A	5: 90,795,283	I48K	probably damaging	Het
Dab2	T	C	15: 6,336,443		probably benign	Het
Ddx54	A	G	5: 120,617,032	E82G	probably benign	Het
Dock1	T	C	7: 135,118,908	W1249R	probably damaging	Het
Fam205a1	C	T	4: 42,851,488	V223I	probably damaging	Het
Fras1	A	C	5: 96,708,757	M2000L	probably benign	Het
Gm13103	T	C	4: 143,853,198	V451A	probably benign	Het
Gm1966	T	C	7: 106,596,847		noncoding transcript	Het
Gpr31b	A	T	17: 13,051,439	I281N	probably damaging	Het
Hecw2	A	G	1: 53,913,300	S925P	probably damaging	Het
Katnal1	A	G	5: 148,921,322	M26T	possibly damaging	Het
Mccc1	C	T	3: 35,990,780	W71*	probably null	Het
Muc6	G	A	7: 141,639,559		probably benign	Het
Nrbp1	T	A	5: 31,250,137	V397D	probably damaging	Het
Nt5dc1	T	A	10: 34,397,240	E187D	probably benign	Het
Olfr378	T	A	11: 73,425,843	I47F	probably benign	Het
Olfr564	C	T	7: 102,804,321	A281V	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ralgapa1	A	G	12: 55,758,032	V493A	probably benign	Het
Ryr2	T	C	13: 11,752,321	T1228A	probably benign	Het
Slc26a3	G	A	12: 31,468,554	V674I	possibly damaging	Het
Srp68	C	A	11: 116,265,474	E147D	probably damaging	Het
Tacr3	T	C	3: 134,829,559	I96T	probably damaging	Het
Tmem236	T	C	2: 14,192,328		probably null	Het
Tmem62	T	A	2: 120,993,607	N254K	probably benign	Het
Tmem79	A	T	3: 88,333,344	L99Q	probably damaging	Het
Trav6-5	A	T	14: 53,491,516	N78Y	probably benign	Het
Trim33	C	T	3: 103,341,681	Q807*	probably null	Het
Ugt1a10	A	G	1: 88,055,809	T110A	probably benign	Het
Vcl	C	T	14: 21,010,102	T603I	probably damaging	Het
Vps8	A	T	16: 21,457,445	T243S	probably damaging	Het
Vps8	A	C	16: 21,533,099	I323L	probably benign	Het
Zfp746	G	C	6: 48,064,395	Q465E	possibly damaging	Het

Other mutations in Haus5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01655:Haus5	APN	7	30663294	splice site	probably benign
IGL02422:Haus5	APN	7	30660146	missense	possibly damaging	0.95
IGL02427:Haus5	APN	7	30661771	missense	probably benign
IGL02626:Haus5	APN	7	30657250	missense	probably damaging	1.00
IGL02695:Haus5	APN	7	30663277	missense	probably damaging	1.00
R0046:Haus5	UTSW	7	30654180	missense	probably benign	0.10
R0046:Haus5	UTSW	7	30654180	missense	probably benign	0.10
R0511:Haus5	UTSW	7	30659067	missense	probably damaging	1.00
R0547:Haus5	UTSW	7	30659083	missense	probably damaging	0.96
R1447:Haus5	UTSW	7	30661791	splice site	probably null
R1711:Haus5	UTSW	7	30657903	nonsense	probably null
R1852:Haus5	UTSW	7	30658501	critical splice donor site	probably null
R1901:Haus5	UTSW	7	30657245	missense	probably damaging	1.00
R2029:Haus5	UTSW	7	30659400	missense	possibly damaging	0.95
R4832:Haus5	UTSW	7	30657027	missense	probably damaging	0.97
R4865:Haus5	UTSW	7	30658555	missense	probably damaging	1.00
R5123:Haus5	UTSW	7	30654226	missense	probably benign	0.23
R5492:Haus5	UTSW	7	30658955	missense	possibly damaging	0.69
R6293:Haus5	UTSW	7	30658976	nonsense	probably null
R6296:Haus5	UTSW	7	30658976	nonsense	probably null
R6297:Haus5	UTSW	7	30658976	nonsense	probably null
R6332:Haus5	UTSW	7	30658976	nonsense	probably null
R6334:Haus5	UTSW	7	30658976	nonsense	probably null
R6964:Haus5	UTSW	7	30657615	missense	probably benign	0.41
R7095:Haus5	UTSW	7	30659572	missense	probably benign	0.06
R7348:Haus5	UTSW	7	30656966	missense	possibly damaging	0.94
R7740:Haus5	UTSW	7	30663253	missense	possibly damaging	0.92
R8329:Haus5	UTSW	7	30659559	missense	possibly damaging	0.85
U24488:Haus5	UTSW	7	30658976	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACCCTGGGCTACTTTTGTG -3'
(R):5'- CTGCTCATCAAGGGAAACTCAG -3'

Sequencing Primer
(F):5'- CCCAAGGTGGACATCTGATG -3'
(R):5'- TCAAGGGAAACTCAGCCAGC -3'

Posted On

2016-07-06