Incidental Mutation 'R5168:Haus5'
ID397395
Institutional Source Beutler Lab
Gene Symbol Haus5
Ensembl Gene ENSMUSG00000078762
Gene NameHAUS augmin-like complex, subunit 5
Synonyms2310022K01Rik
MMRRC Submission 042748-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R5168 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30653711-30664994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30657711 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 432 (T432A)
Ref Sequence ENSEMBL: ENSMUSP00000019697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019697] [ENSMUST00000132862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019697
AA Change: T432A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019697
Gene: ENSMUSG00000078762
AA Change: T432A

DomainStartEndE-ValueType
Pfam:HAUS5 7 617 9.8e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126511
Predicted Effect probably benign
Transcript: ENSMUST00000132862
AA Change: T432A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121739
Gene: ENSMUSG00000078762
AA Change: T432A

DomainStartEndE-ValueType
Pfam:HAUS5 5 515 4.4e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181529
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HAUS5 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]; Uehara et al., 2009 [PubMed 19369198]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,086,070 N478D probably benign Het
Acsl1 T A 8: 46,513,266 probably benign Het
Aox1 T A 1: 58,049,402 C116S probably damaging Het
Bag6 T C 17: 35,144,695 L785P probably damaging Het
Calcr T C 6: 3,708,610 N192S probably benign Het
Cntrl T A 2: 35,157,655 L1414H probably damaging Het
Cntrob T A 11: 69,299,990 I849F possibly damaging Het
Col6a3 C T 1: 90,773,639 W2518* probably null Het
Cxcl15 T A 5: 90,795,283 I48K probably damaging Het
Dab2 T C 15: 6,336,443 probably benign Het
Ddx54 A G 5: 120,617,032 E82G probably benign Het
Dock1 T C 7: 135,118,908 W1249R probably damaging Het
Fam205a1 C T 4: 42,851,488 V223I probably damaging Het
Fras1 A C 5: 96,708,757 M2000L probably benign Het
Gm13103 T C 4: 143,853,198 V451A probably benign Het
Gm1966 T C 7: 106,596,847 noncoding transcript Het
Gpr31b A T 17: 13,051,439 I281N probably damaging Het
Hecw2 A G 1: 53,913,300 S925P probably damaging Het
Katnal1 A G 5: 148,921,322 M26T possibly damaging Het
Mccc1 C T 3: 35,990,780 W71* probably null Het
Muc6 G A 7: 141,639,559 probably benign Het
Nrbp1 T A 5: 31,250,137 V397D probably damaging Het
Nt5dc1 T A 10: 34,397,240 E187D probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Olfr564 C T 7: 102,804,321 A281V probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ralgapa1 A G 12: 55,758,032 V493A probably benign Het
Ryr2 T C 13: 11,752,321 T1228A probably benign Het
Slc26a3 G A 12: 31,468,554 V674I possibly damaging Het
Srp68 C A 11: 116,265,474 E147D probably damaging Het
Tacr3 T C 3: 134,829,559 I96T probably damaging Het
Tmem236 T C 2: 14,192,328 probably null Het
Tmem62 T A 2: 120,993,607 N254K probably benign Het
Tmem79 A T 3: 88,333,344 L99Q probably damaging Het
Trav6-5 A T 14: 53,491,516 N78Y probably benign Het
Trim33 C T 3: 103,341,681 Q807* probably null Het
Ugt1a10 A G 1: 88,055,809 T110A probably benign Het
Vcl C T 14: 21,010,102 T603I probably damaging Het
Vps8 A T 16: 21,457,445 T243S probably damaging Het
Vps8 A C 16: 21,533,099 I323L probably benign Het
Zfp746 G C 6: 48,064,395 Q465E possibly damaging Het
Other mutations in Haus5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Haus5 APN 7 30663294 splice site probably benign
IGL02422:Haus5 APN 7 30660146 missense possibly damaging 0.95
IGL02427:Haus5 APN 7 30661771 missense probably benign
IGL02626:Haus5 APN 7 30657250 missense probably damaging 1.00
IGL02695:Haus5 APN 7 30663277 missense probably damaging 1.00
R0046:Haus5 UTSW 7 30654180 missense probably benign 0.10
R0046:Haus5 UTSW 7 30654180 missense probably benign 0.10
R0511:Haus5 UTSW 7 30659067 missense probably damaging 1.00
R0547:Haus5 UTSW 7 30659083 missense probably damaging 0.96
R1447:Haus5 UTSW 7 30661791 splice site probably null
R1711:Haus5 UTSW 7 30657903 nonsense probably null
R1852:Haus5 UTSW 7 30658501 critical splice donor site probably null
R1901:Haus5 UTSW 7 30657245 missense probably damaging 1.00
R2029:Haus5 UTSW 7 30659400 missense possibly damaging 0.95
R4832:Haus5 UTSW 7 30657027 missense probably damaging 0.97
R4865:Haus5 UTSW 7 30658555 missense probably damaging 1.00
R5123:Haus5 UTSW 7 30654226 missense probably benign 0.23
R5492:Haus5 UTSW 7 30658955 missense possibly damaging 0.69
R6293:Haus5 UTSW 7 30658976 nonsense probably null
R6296:Haus5 UTSW 7 30658976 nonsense probably null
R6297:Haus5 UTSW 7 30658976 nonsense probably null
R6332:Haus5 UTSW 7 30658976 nonsense probably null
R6334:Haus5 UTSW 7 30658976 nonsense probably null
R6964:Haus5 UTSW 7 30657615 missense probably benign 0.41
R7095:Haus5 UTSW 7 30659572 missense probably benign 0.06
R7348:Haus5 UTSW 7 30656966 missense possibly damaging 0.94
R7740:Haus5 UTSW 7 30663253 missense possibly damaging 0.92
U24488:Haus5 UTSW 7 30658976 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCCTGGGCTACTTTTGTG -3'
(R):5'- CTGCTCATCAAGGGAAACTCAG -3'

Sequencing Primer
(F):5'- CCCAAGGTGGACATCTGATG -3'
(R):5'- TCAAGGGAAACTCAGCCAGC -3'
Posted On2016-07-06